SlideShare a Scribd company logo
1 of 27
Download to read offline
Breeding activities in
Thailand
Establishing sustainable solutions to cassava diseases in mainland
Southeast Asia Project Inception Meeting
Vientiane Lao PDR
11-13th September 2019
Chalermpol Phumichai, Chareinsuk Rojanaridpiched , Ed Sarobol, Vichan Vichukit,
Wannasiri Wannarat, Wanwisa Siriwan, Pasajee Kongsil, Piya Kittipadakul, Pornsak Aiemnaka
• Sources of resistance to CMD available from CIAT,
TME3 and C33 were introduced to Thailand in
March 2013
• However, CMD was not reported in
Southeast Asia until May2015
2
Twenty-one tissue-cultured plants were
introduced to Thailand
(2013)
3
➢ 2015 : First report CMD outbreak
in Ratanakiri province,
Cambodia.
Wang et al. (2016)
➢ 2017 : First outbreak in Tay Ninh
province, Vietnam
Hoat et al.(2017 )
CMD outbreak in southeast Asia
https://www.pinterest.com/pin/340
725528040857318/
4
Linkage map of CMD2-associated marker; the numbers above refer to the genetic distances in cM
(centiMorgan)
Name
Position
Type of
repeat
Left primer Right primer
Product
Size(bp.)
SSRY 28 SSR TTGAACATGAGTGATATTTTCTTG
AG
GCTGCGTGCAAAACTAAA
AT
180
158 SSR GTGCGAAATGGAAATCAATG
TGAAATAGTGATACATGC
AAAAGGA
166
169 SSR GTGCGAAATGGAAATCAATG
GCCTTCTCAGCATATGGA
GC
319
RMEI SCAR ATGTTAATGTTATGAAAGAGC
AGAAGAGGGTAGGAGTT
ATGT
700
Oliveira et al. (2015)
5
Identification of CMD-resistance progenies was performed using NS158,
NS169, SSRY28 and RME1 markers
NS 169
6
(GLM)
S12_7926132
S12_7926163
S12_7954303
S12_7954248
S14_9004550
S14_4626854
CMD2 Locus
Selection of CMD2 resistance alleles using markers in the High
Throughput Genotyping Platform
GCP21 Special Meeting on CMD in Asia
Phnom Penh, Cambodia
Sept 18-20, 2018
Contact: p.kulakow@cgiar.org
7
The first evaluation takes place in seedling stage
8
123-1
179-3179-3
123-1
The first evaluation takes place in seedling stage
9
179-8179-8
179-4179-4
TME3
179-3
179_3
Pre screening for resistance to CMD by grafting tools
10
Plant Protection Research and Development Office
Department of Agriculture
179_5
R11
Pre screening for resistance to CMD by grafting tools
11
Plant Protection Research and Development Office
Department of Agriculture
Development of disease symptoms on the leaf of cassava plants after grafting inoculation
Evaluation of resistance to cassava mosaic disease strain
Sri Lankan in selected Thai commercial varieties using
greenhouse grafting method
12
Evaluation of resistance to cassava mosaic disease
strain Sri Lankan in selected Thai commercial
varieties using greenhouse grafting method
13
14
Evaluation of resistance to cassava mosaic disease strain Sri Lankan in
selected Thai commercial varieties using greenhouse grafting method
No. Cultivar name Mean CMD severity score
2 WAI 3 WAI 4 WAI 5 WAI 6 WAI 7 WAI 8 WAI
1 TME3 0.00 c 1.25 b 1.50 b 2.00 c 2.00 c 2.00 c 2.00 c
2 Rayong11 2.00 a 4.00 a 4.00 a 4.00 a 4.00 a 4.00 a 4.00 a
3 CMR-89 1.00 b 1.75 b 2.50 b 3.25 ab 3.25 ab 3.25 b 3.25 b
4 Kasetsart 50 1.00 b 2.00 b 2.50 b 2.75 bc 2.75 bc 3.00 b 3.00 b
5 Huay Bong 60 1.00 b 1.75 b 2.25 b 2.50 bc 2.75 bc 3.00 b 3.00 b
6 Huay Bong 80 1.25 b 2.00 b 2.00 b 2.25 bc 2.50 bc 3.00 b 3.00 b
7 Huay Bong 90 1.00 b 1.00 b 2.25 b 2.25 bc 2.75 bc 2.75 b 2.75 b
Tukeys's Honest Significant Difference (HSD) Test * P value (α)= 0.05
Severity of Sri Lankan cassava mosaic disease (SLCMD) on 7 cultivar of cassava 2-8
weeks after inoculation (WAI)
Development of disease symptoms on the leaf of cassava plants after grafting
inoculation
Progress in disease incidence in 6 week old plants of CMR-89 after grafting inoculation
with TME3, Rayong11, CRM-89, Kasetsart 50, Huay Bong 60, Huay Bong 80 and Huay
Bong 90. Data shown at the average of five replications.
15
CMD-resistant cassava cultivars from IITA
Nov 2018
TME B419
IITA-TMS-IBA980581
IITA-TMS-IBA980505
IITA-TMS-IBA972205
IITA-TMS-IBA920057
16
17
Micropropagation of CMD cassava varieties
Transplantation of TC CMD seedlings at TDI
Clone
Tissue culture seedlings
(Sep 2018 - May 2019)
Transplanting period Survival rate of transplants
after planting 1 month
C33 6,384 June-Sep 2019 100%
TME-3 8,428 June-Sep 2019 100% 18
1 month 2 months 3 months
TME3 and C33 are planting for general yield trial in 3
locations comparing with commercial varieties
Suwan Farm field trial
TDI field trial
Khao Hin Sorn field trial
19
TME3 and C33 are planting for general yield trial in spreading CMD field
20
Flower induction experiment @ TDI,
Pruning technique
21
Flower induction experiment @ TDI, Huay Bong, Nakorn Rachasrima
(The North-Eastern part of Thailand)
323 meters above sea level
Three-month old Rayong 72
flowering at
the first fork branching
Three-month old TME3 (left)
and C33 (right)
had the first forking.
Varieties Red light No red light
KU50 - -
HB80 Forking Forking
HB90 - -
R5 Forking Forking
R9 - -
R72 Forking Forking
TME3 Forking Forking
C33 Forking Forking
22
Two-month old Rayong 5
flowering at
the first fork branching
Varieties Red light No red light
KU50 - -
HB80 flowering Flowering
HB90 - -
R5 flowering flowering
R9 - -
R72 - -
Flower induction experiment @ Doi Pui Hill, Chiang Mai (The Northern
part of Thailand)
1,260 meters above sea level
23
Botanical seed to be imported from Hawaii
All seeds are open pollinated,
we only know about the female progenitor.
24
Development of early generation inbred line (EGIL)
in Cassava
25
S1 and S2 in Cassava
• Developed from KU50 R5 R1
• Selected ~ 500 S1 and S1 lines got 51 potential lines
for good yield
• Will using the potential lines for using as parents to
develop resistant lines for CMD resistant varieties
26
Proposed scheme for fast track introgression of CMD2 into SE Asian
cassava breeding populations and rapid breaking of undesirable linkages
Acknowledgements
Thank You
27

More Related Content

Similar to Breeding activities in Thailand

International Winter Wheat Improvement Program: breeding strategies and meth...
International Winter Wheat Improvement Program: breeding strategies and meth...International Winter Wheat Improvement Program: breeding strategies and meth...
International Winter Wheat Improvement Program: breeding strategies and meth...ICARDA
 
Maize in Asia – Status, Challenges and Opportunities
Maize in Asia – Status, Challenges and OpportunitiesMaize in Asia – Status, Challenges and Opportunities
Maize in Asia – Status, Challenges and OpportunitiesCIMMYT
 
IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...
IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...
IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...IRJET Journal
 
Perception of Sathgudi orange growers on contract farming
Perception of Sathgudi orange growers on contract farmingPerception of Sathgudi orange growers on contract farming
Perception of Sathgudi orange growers on contract farminghindagrihorticulturalsociety
 
ADVANCES IN PROPAGATION OF POTATO.pptx
ADVANCES IN  PROPAGATION OF POTATO.pptxADVANCES IN  PROPAGATION OF POTATO.pptx
ADVANCES IN PROPAGATION OF POTATO.pptxBalchandraHalshetty
 
Bacterial wilt resistance breeding in brinjal
Bacterial wilt resistance breeding in brinjalBacterial wilt resistance breeding in brinjal
Bacterial wilt resistance breeding in brinjalBasavaraj Panjagal
 
Cotton pink bollworm survey
Cotton pink bollworm survey  Cotton pink bollworm survey
Cotton pink bollworm survey Gaurang Rudani
 
Noel APS Poster-3_Final
Noel APS Poster-3_FinalNoel APS Poster-3_Final
Noel APS Poster-3_FinalNicholas Noël
 
Diallel analysis in blackgram M.sc agri thesis viva
Diallel analysis in blackgram M.sc agri thesis vivaDiallel analysis in blackgram M.sc agri thesis viva
Diallel analysis in blackgram M.sc agri thesis vivaRahulselvaraj
 
"Avenues and issues in applying biotechnology in the small and medium scale s...
"Avenues and issues in applying biotechnology in the small and medium scale s..."Avenues and issues in applying biotechnology in the small and medium scale s...
"Avenues and issues in applying biotechnology in the small and medium scale s...Rajeev Taggar
 
Bio-securing Sub-Saharan Africa from Transboundary Maize Lethal Dr. SURESH,...
Bio-securing Sub-Saharan Africa from Transboundary Maize Lethal   Dr. SURESH,...Bio-securing Sub-Saharan Africa from Transboundary Maize Lethal   Dr. SURESH,...
Bio-securing Sub-Saharan Africa from Transboundary Maize Lethal Dr. SURESH,...Suresh, L.M
 
Maize for Asian tropics: Chasing the moving target
Maize for Asian tropics: Chasing the moving targetMaize for Asian tropics: Chasing the moving target
Maize for Asian tropics: Chasing the moving targetCIMMYT
 
The development of two sweet corn populations resistance to northern corn lea...
The development of two sweet corn populations resistance to northern corn lea...The development of two sweet corn populations resistance to northern corn lea...
The development of two sweet corn populations resistance to northern corn lea...CIMMYT
 

Similar to Breeding activities in Thailand (20)

International Winter Wheat Improvement Program: breeding strategies and meth...
International Winter Wheat Improvement Program: breeding strategies and meth...International Winter Wheat Improvement Program: breeding strategies and meth...
International Winter Wheat Improvement Program: breeding strategies and meth...
 
0619 The System of Rice Intensification (SRI)
0619 The System of Rice Intensification (SRI)0619 The System of Rice Intensification (SRI)
0619 The System of Rice Intensification (SRI)
 
The System of Rice Intensification (SRI)
The System of Rice Intensification (SRI)The System of Rice Intensification (SRI)
The System of Rice Intensification (SRI)
 
Maize in Asia – Status, Challenges and Opportunities
Maize in Asia – Status, Challenges and OpportunitiesMaize in Asia – Status, Challenges and Opportunities
Maize in Asia – Status, Challenges and Opportunities
 
IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...
IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...
IRJET- Analysis of Hybrid Purity in Watermelon using Microsatellite Marker in...
 
Bioteknologi
BioteknologiBioteknologi
Bioteknologi
 
0870 Cost-Benefit Analysis of SRI Technique in Paddy Cultivation
0870 Cost-Benefit Analysis of SRI Technique in Paddy Cultivation0870 Cost-Benefit Analysis of SRI Technique in Paddy Cultivation
0870 Cost-Benefit Analysis of SRI Technique in Paddy Cultivation
 
Perception of Sathgudi orange growers on contract farming
Perception of Sathgudi orange growers on contract farmingPerception of Sathgudi orange growers on contract farming
Perception of Sathgudi orange growers on contract farming
 
ADVANCES IN PROPAGATION OF POTATO.pptx
ADVANCES IN  PROPAGATION OF POTATO.pptxADVANCES IN  PROPAGATION OF POTATO.pptx
ADVANCES IN PROPAGATION OF POTATO.pptx
 
Bacterial wilt resistance breeding in brinjal
Bacterial wilt resistance breeding in brinjalBacterial wilt resistance breeding in brinjal
Bacterial wilt resistance breeding in brinjal
 
Cotton pink bollworm survey
Cotton pink bollworm survey  Cotton pink bollworm survey
Cotton pink bollworm survey
 
Sj iwmt mzoa==
Sj iwmt mzoa==Sj iwmt mzoa==
Sj iwmt mzoa==
 
High Tunnel Pest Exclusion System Updates (Vegetable IPM)
High Tunnel Pest Exclusion System Updates (Vegetable IPM)High Tunnel Pest Exclusion System Updates (Vegetable IPM)
High Tunnel Pest Exclusion System Updates (Vegetable IPM)
 
Noel APS Poster-3_Final
Noel APS Poster-3_FinalNoel APS Poster-3_Final
Noel APS Poster-3_Final
 
Diallel analysis in blackgram M.sc agri thesis viva
Diallel analysis in blackgram M.sc agri thesis vivaDiallel analysis in blackgram M.sc agri thesis viva
Diallel analysis in blackgram M.sc agri thesis viva
 
A region-wide response to emerging cassava pests and diseases in SE Asia
A region-wide response to emerging cassava pests and diseases in SE AsiaA region-wide response to emerging cassava pests and diseases in SE Asia
A region-wide response to emerging cassava pests and diseases in SE Asia
 
"Avenues and issues in applying biotechnology in the small and medium scale s...
"Avenues and issues in applying biotechnology in the small and medium scale s..."Avenues and issues in applying biotechnology in the small and medium scale s...
"Avenues and issues in applying biotechnology in the small and medium scale s...
 
Bio-securing Sub-Saharan Africa from Transboundary Maize Lethal Dr. SURESH,...
Bio-securing Sub-Saharan Africa from Transboundary Maize Lethal   Dr. SURESH,...Bio-securing Sub-Saharan Africa from Transboundary Maize Lethal   Dr. SURESH,...
Bio-securing Sub-Saharan Africa from Transboundary Maize Lethal Dr. SURESH,...
 
Maize for Asian tropics: Chasing the moving target
Maize for Asian tropics: Chasing the moving targetMaize for Asian tropics: Chasing the moving target
Maize for Asian tropics: Chasing the moving target
 
The development of two sweet corn populations resistance to northern corn lea...
The development of two sweet corn populations resistance to northern corn lea...The development of two sweet corn populations resistance to northern corn lea...
The development of two sweet corn populations resistance to northern corn lea...
 

More from Sustainable Cassava Disease Solutions Asia

Big data solutions for smallholder farmers in Southeast Asia: machine learnin...
Big data solutions for smallholder farmers in Southeast Asia: machine learnin...Big data solutions for smallholder farmers in Southeast Asia: machine learnin...
Big data solutions for smallholder farmers in Southeast Asia: machine learnin...Sustainable Cassava Disease Solutions Asia
 
An Integrated Management Response to the spread of Fusarium wilt of Banana in...
An Integrated Management Response to the spread of Fusarium wilt of Banana in...An Integrated Management Response to the spread of Fusarium wilt of Banana in...
An Integrated Management Response to the spread of Fusarium wilt of Banana in...Sustainable Cassava Disease Solutions Asia
 
Project Introduction - Establishing sustainable solutions to cassava disease ...
Project Introduction - Establishing sustainable solutions to cassava disease ...Project Introduction - Establishing sustainable solutions to cassava disease ...
Project Introduction - Establishing sustainable solutions to cassava disease ...Sustainable Cassava Disease Solutions Asia
 

More from Sustainable Cassava Disease Solutions Asia (15)

Big data solutions for smallholder farmers in Southeast Asia: machine learnin...
Big data solutions for smallholder farmers in Southeast Asia: machine learnin...Big data solutions for smallholder farmers in Southeast Asia: machine learnin...
Big data solutions for smallholder farmers in Southeast Asia: machine learnin...
 
An Integrated Management Response to the spread of Fusarium wilt of Banana in...
An Integrated Management Response to the spread of Fusarium wilt of Banana in...An Integrated Management Response to the spread of Fusarium wilt of Banana in...
An Integrated Management Response to the spread of Fusarium wilt of Banana in...
 
RTB Rapid response to transboundary and emerging diseases
RTB Rapid response to transboundary and emerging diseasesRTB Rapid response to transboundary and emerging diseases
RTB Rapid response to transboundary and emerging diseases
 
Cassava disease status in Laos
Cassava disease status in LaosCassava disease status in Laos
Cassava disease status in Laos
 
Through a gender and social inclusion lens
Through a gender and social inclusion lensThrough a gender and social inclusion lens
Through a gender and social inclusion lens
 
Inception meeting - Cambodia
Inception meeting - CambodiaInception meeting - Cambodia
Inception meeting - Cambodia
 
Update on CMD and CWBD in Thailand
Update on CMD and CWBD in ThailandUpdate on CMD and CWBD in Thailand
Update on CMD and CWBD in Thailand
 
CIATs Cassava Breeding Approach to solve the CMD outbreak in SEA
CIATs Cassava Breeding Approach to solve the CMD outbreak in SEACIATs Cassava Breeding Approach to solve the CMD outbreak in SEA
CIATs Cassava Breeding Approach to solve the CMD outbreak in SEA
 
Effect of CMD on cassava root yield
Effect of CMD on cassava root yieldEffect of CMD on cassava root yield
Effect of CMD on cassava root yield
 
Update of cassava CMD in China
Update of cassava CMD in ChinaUpdate of cassava CMD in China
Update of cassava CMD in China
 
Cassava breeding and screening activities in China
Cassava breeding and screening activities in ChinaCassava breeding and screening activities in China
Cassava breeding and screening activities in China
 
Screening for CMD resistance/tolerance varieties 2018-19
Screening for CMD resistance/tolerance varieties 2018-19Screening for CMD resistance/tolerance varieties 2018-19
Screening for CMD resistance/tolerance varieties 2018-19
 
Thai Tapioca Industry - Introduction to TTSA
Thai Tapioca Industry - Introduction to TTSAThai Tapioca Industry - Introduction to TTSA
Thai Tapioca Industry - Introduction to TTSA
 
Update Report - Cassava mosaivc virus disease (SLCMV) in Vietnam
Update Report - Cassava mosaivc virus disease (SLCMV) in VietnamUpdate Report - Cassava mosaivc virus disease (SLCMV) in Vietnam
Update Report - Cassava mosaivc virus disease (SLCMV) in Vietnam
 
Project Introduction - Establishing sustainable solutions to cassava disease ...
Project Introduction - Establishing sustainable solutions to cassava disease ...Project Introduction - Establishing sustainable solutions to cassava disease ...
Project Introduction - Establishing sustainable solutions to cassava disease ...
 

Recently uploaded

(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Service
(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Service(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Service
(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Serviceranjana rawat
 
Fair Trash Reduction - West Hartford, CT
Fair Trash Reduction - West Hartford, CTFair Trash Reduction - West Hartford, CT
Fair Trash Reduction - West Hartford, CTaccounts329278
 
Expressive clarity oral presentation.pptx
Expressive clarity oral presentation.pptxExpressive clarity oral presentation.pptx
Expressive clarity oral presentation.pptxtsionhagos36
 
2024: The FAR, Federal Acquisition Regulations - Part 29
2024: The FAR, Federal Acquisition Regulations - Part 292024: The FAR, Federal Acquisition Regulations - Part 29
2024: The FAR, Federal Acquisition Regulations - Part 29JSchaus & Associates
 
Top Rated Pune Call Girls Bhosari ⟟ 6297143586 ⟟ Call Me For Genuine Sex Ser...
Top Rated  Pune Call Girls Bhosari ⟟ 6297143586 ⟟ Call Me For Genuine Sex Ser...Top Rated  Pune Call Girls Bhosari ⟟ 6297143586 ⟟ Call Me For Genuine Sex Ser...
Top Rated Pune Call Girls Bhosari ⟟ 6297143586 ⟟ Call Me For Genuine Sex Ser...Call Girls in Nagpur High Profile
 
Night 7k to 12k Call Girls Service In Navi Mumbai 👉 BOOK NOW 9833363713 👈 ♀️...
Night 7k to 12k  Call Girls Service In Navi Mumbai 👉 BOOK NOW 9833363713 👈 ♀️...Night 7k to 12k  Call Girls Service In Navi Mumbai 👉 BOOK NOW 9833363713 👈 ♀️...
Night 7k to 12k Call Girls Service In Navi Mumbai 👉 BOOK NOW 9833363713 👈 ♀️...aartirawatdelhi
 
(SHINA) Call Girls Khed ( 7001035870 ) HI-Fi Pune Escorts Service
(SHINA) Call Girls Khed ( 7001035870 ) HI-Fi Pune Escorts Service(SHINA) Call Girls Khed ( 7001035870 ) HI-Fi Pune Escorts Service
(SHINA) Call Girls Khed ( 7001035870 ) HI-Fi Pune Escorts Serviceranjana rawat
 
The Economic and Organised Crime Office (EOCO) has been advised by the Office...
The Economic and Organised Crime Office (EOCO) has been advised by the Office...The Economic and Organised Crime Office (EOCO) has been advised by the Office...
The Economic and Organised Crime Office (EOCO) has been advised by the Office...nservice241
 
VIP Russian Call Girls in Indore Ishita 💚😋 9256729539 🚀 Indore Escorts
VIP Russian Call Girls in Indore Ishita 💚😋  9256729539 🚀 Indore EscortsVIP Russian Call Girls in Indore Ishita 💚😋  9256729539 🚀 Indore Escorts
VIP Russian Call Girls in Indore Ishita 💚😋 9256729539 🚀 Indore Escortsaditipandeya
 
Call On 6297143586 Viman Nagar Call Girls In All Pune 24/7 Provide Call With...
Call On 6297143586  Viman Nagar Call Girls In All Pune 24/7 Provide Call With...Call On 6297143586  Viman Nagar Call Girls In All Pune 24/7 Provide Call With...
Call On 6297143586 Viman Nagar Call Girls In All Pune 24/7 Provide Call With...tanu pandey
 
Just Call Vip call girls Wardha Escorts ☎️8617370543 Starting From 5K to 25K ...
Just Call Vip call girls Wardha Escorts ☎️8617370543 Starting From 5K to 25K ...Just Call Vip call girls Wardha Escorts ☎️8617370543 Starting From 5K to 25K ...
Just Call Vip call girls Wardha Escorts ☎️8617370543 Starting From 5K to 25K ...Dipal Arora
 
Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...
Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...
Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...anilsa9823
 
2024: The FAR, Federal Acquisition Regulations, Part 30
2024: The FAR, Federal Acquisition Regulations, Part 302024: The FAR, Federal Acquisition Regulations, Part 30
2024: The FAR, Federal Acquisition Regulations, Part 30JSchaus & Associates
 
The U.S. Budget and Economic Outlook (Presentation)
The U.S. Budget and Economic Outlook (Presentation)The U.S. Budget and Economic Outlook (Presentation)
The U.S. Budget and Economic Outlook (Presentation)Congressional Budget Office
 
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...CedZabala
 
Incident Command System xxxxxxxxxxxxxxxxxxxxxxxxx
Incident Command System xxxxxxxxxxxxxxxxxxxxxxxxxIncident Command System xxxxxxxxxxxxxxxxxxxxxxxxx
Incident Command System xxxxxxxxxxxxxxxxxxxxxxxxxPeter Miles
 
(TARA) Call Girls Chakan ( 7001035870 ) HI-Fi Pune Escorts Service
(TARA) Call Girls Chakan ( 7001035870 ) HI-Fi Pune Escorts Service(TARA) Call Girls Chakan ( 7001035870 ) HI-Fi Pune Escorts Service
(TARA) Call Girls Chakan ( 7001035870 ) HI-Fi Pune Escorts Serviceranjana rawat
 

Recently uploaded (20)

(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Service
(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Service(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Service
(PRIYA) Call Girls Rajgurunagar ( 7001035870 ) HI-Fi Pune Escorts Service
 
Rohini Sector 37 Call Girls Delhi 9999965857 @Sabina Saikh No Advance
Rohini Sector 37 Call Girls Delhi 9999965857 @Sabina Saikh No AdvanceRohini Sector 37 Call Girls Delhi 9999965857 @Sabina Saikh No Advance
Rohini Sector 37 Call Girls Delhi 9999965857 @Sabina Saikh No Advance
 
Fair Trash Reduction - West Hartford, CT
Fair Trash Reduction - West Hartford, CTFair Trash Reduction - West Hartford, CT
Fair Trash Reduction - West Hartford, CT
 
Expressive clarity oral presentation.pptx
Expressive clarity oral presentation.pptxExpressive clarity oral presentation.pptx
Expressive clarity oral presentation.pptx
 
2024: The FAR, Federal Acquisition Regulations - Part 29
2024: The FAR, Federal Acquisition Regulations - Part 292024: The FAR, Federal Acquisition Regulations - Part 29
2024: The FAR, Federal Acquisition Regulations - Part 29
 
Top Rated Pune Call Girls Bhosari ⟟ 6297143586 ⟟ Call Me For Genuine Sex Ser...
Top Rated  Pune Call Girls Bhosari ⟟ 6297143586 ⟟ Call Me For Genuine Sex Ser...Top Rated  Pune Call Girls Bhosari ⟟ 6297143586 ⟟ Call Me For Genuine Sex Ser...
Top Rated Pune Call Girls Bhosari ⟟ 6297143586 ⟟ Call Me For Genuine Sex Ser...
 
Night 7k to 12k Call Girls Service In Navi Mumbai 👉 BOOK NOW 9833363713 👈 ♀️...
Night 7k to 12k  Call Girls Service In Navi Mumbai 👉 BOOK NOW 9833363713 👈 ♀️...Night 7k to 12k  Call Girls Service In Navi Mumbai 👉 BOOK NOW 9833363713 👈 ♀️...
Night 7k to 12k Call Girls Service In Navi Mumbai 👉 BOOK NOW 9833363713 👈 ♀️...
 
(SHINA) Call Girls Khed ( 7001035870 ) HI-Fi Pune Escorts Service
(SHINA) Call Girls Khed ( 7001035870 ) HI-Fi Pune Escorts Service(SHINA) Call Girls Khed ( 7001035870 ) HI-Fi Pune Escorts Service
(SHINA) Call Girls Khed ( 7001035870 ) HI-Fi Pune Escorts Service
 
The Economic and Organised Crime Office (EOCO) has been advised by the Office...
The Economic and Organised Crime Office (EOCO) has been advised by the Office...The Economic and Organised Crime Office (EOCO) has been advised by the Office...
The Economic and Organised Crime Office (EOCO) has been advised by the Office...
 
VIP Russian Call Girls in Indore Ishita 💚😋 9256729539 🚀 Indore Escorts
VIP Russian Call Girls in Indore Ishita 💚😋  9256729539 🚀 Indore EscortsVIP Russian Call Girls in Indore Ishita 💚😋  9256729539 🚀 Indore Escorts
VIP Russian Call Girls in Indore Ishita 💚😋 9256729539 🚀 Indore Escorts
 
Call On 6297143586 Viman Nagar Call Girls In All Pune 24/7 Provide Call With...
Call On 6297143586  Viman Nagar Call Girls In All Pune 24/7 Provide Call With...Call On 6297143586  Viman Nagar Call Girls In All Pune 24/7 Provide Call With...
Call On 6297143586 Viman Nagar Call Girls In All Pune 24/7 Provide Call With...
 
Just Call Vip call girls Wardha Escorts ☎️8617370543 Starting From 5K to 25K ...
Just Call Vip call girls Wardha Escorts ☎️8617370543 Starting From 5K to 25K ...Just Call Vip call girls Wardha Escorts ☎️8617370543 Starting From 5K to 25K ...
Just Call Vip call girls Wardha Escorts ☎️8617370543 Starting From 5K to 25K ...
 
Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...
Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...
Lucknow 💋 Russian Call Girls Lucknow ₹7.5k Pick Up & Drop With Cash Payment 8...
 
Delhi Russian Call Girls In Connaught Place ➡️9999965857 India's Finest Model...
Delhi Russian Call Girls In Connaught Place ➡️9999965857 India's Finest Model...Delhi Russian Call Girls In Connaught Place ➡️9999965857 India's Finest Model...
Delhi Russian Call Girls In Connaught Place ➡️9999965857 India's Finest Model...
 
Call Girls Service Connaught Place @9999965857 Delhi 🫦 No Advance VVIP 🍎 SER...
Call Girls Service Connaught Place @9999965857 Delhi 🫦 No Advance  VVIP 🍎 SER...Call Girls Service Connaught Place @9999965857 Delhi 🫦 No Advance  VVIP 🍎 SER...
Call Girls Service Connaught Place @9999965857 Delhi 🫦 No Advance VVIP 🍎 SER...
 
2024: The FAR, Federal Acquisition Regulations, Part 30
2024: The FAR, Federal Acquisition Regulations, Part 302024: The FAR, Federal Acquisition Regulations, Part 30
2024: The FAR, Federal Acquisition Regulations, Part 30
 
The U.S. Budget and Economic Outlook (Presentation)
The U.S. Budget and Economic Outlook (Presentation)The U.S. Budget and Economic Outlook (Presentation)
The U.S. Budget and Economic Outlook (Presentation)
 
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
Artificial Intelligence in Philippine Local Governance: Challenges and Opport...
 
Incident Command System xxxxxxxxxxxxxxxxxxxxxxxxx
Incident Command System xxxxxxxxxxxxxxxxxxxxxxxxxIncident Command System xxxxxxxxxxxxxxxxxxxxxxxxx
Incident Command System xxxxxxxxxxxxxxxxxxxxxxxxx
 
(TARA) Call Girls Chakan ( 7001035870 ) HI-Fi Pune Escorts Service
(TARA) Call Girls Chakan ( 7001035870 ) HI-Fi Pune Escorts Service(TARA) Call Girls Chakan ( 7001035870 ) HI-Fi Pune Escorts Service
(TARA) Call Girls Chakan ( 7001035870 ) HI-Fi Pune Escorts Service
 

Breeding activities in Thailand

  • 1. Breeding activities in Thailand Establishing sustainable solutions to cassava diseases in mainland Southeast Asia Project Inception Meeting Vientiane Lao PDR 11-13th September 2019 Chalermpol Phumichai, Chareinsuk Rojanaridpiched , Ed Sarobol, Vichan Vichukit, Wannasiri Wannarat, Wanwisa Siriwan, Pasajee Kongsil, Piya Kittipadakul, Pornsak Aiemnaka
  • 2. • Sources of resistance to CMD available from CIAT, TME3 and C33 were introduced to Thailand in March 2013 • However, CMD was not reported in Southeast Asia until May2015 2
  • 3. Twenty-one tissue-cultured plants were introduced to Thailand (2013) 3
  • 4. ➢ 2015 : First report CMD outbreak in Ratanakiri province, Cambodia. Wang et al. (2016) ➢ 2017 : First outbreak in Tay Ninh province, Vietnam Hoat et al.(2017 ) CMD outbreak in southeast Asia https://www.pinterest.com/pin/340 725528040857318/ 4
  • 5. Linkage map of CMD2-associated marker; the numbers above refer to the genetic distances in cM (centiMorgan) Name Position Type of repeat Left primer Right primer Product Size(bp.) SSRY 28 SSR TTGAACATGAGTGATATTTTCTTG AG GCTGCGTGCAAAACTAAA AT 180 158 SSR GTGCGAAATGGAAATCAATG TGAAATAGTGATACATGC AAAAGGA 166 169 SSR GTGCGAAATGGAAATCAATG GCCTTCTCAGCATATGGA GC 319 RMEI SCAR ATGTTAATGTTATGAAAGAGC AGAAGAGGGTAGGAGTT ATGT 700 Oliveira et al. (2015) 5
  • 6. Identification of CMD-resistance progenies was performed using NS158, NS169, SSRY28 and RME1 markers NS 169 6
  • 7. (GLM) S12_7926132 S12_7926163 S12_7954303 S12_7954248 S14_9004550 S14_4626854 CMD2 Locus Selection of CMD2 resistance alleles using markers in the High Throughput Genotyping Platform GCP21 Special Meeting on CMD in Asia Phnom Penh, Cambodia Sept 18-20, 2018 Contact: p.kulakow@cgiar.org 7
  • 8. The first evaluation takes place in seedling stage 8 123-1 179-3179-3 123-1
  • 9. The first evaluation takes place in seedling stage 9 179-8179-8 179-4179-4
  • 10. TME3 179-3 179_3 Pre screening for resistance to CMD by grafting tools 10 Plant Protection Research and Development Office Department of Agriculture
  • 11. 179_5 R11 Pre screening for resistance to CMD by grafting tools 11 Plant Protection Research and Development Office Department of Agriculture
  • 12. Development of disease symptoms on the leaf of cassava plants after grafting inoculation Evaluation of resistance to cassava mosaic disease strain Sri Lankan in selected Thai commercial varieties using greenhouse grafting method 12
  • 13. Evaluation of resistance to cassava mosaic disease strain Sri Lankan in selected Thai commercial varieties using greenhouse grafting method 13
  • 14. 14 Evaluation of resistance to cassava mosaic disease strain Sri Lankan in selected Thai commercial varieties using greenhouse grafting method No. Cultivar name Mean CMD severity score 2 WAI 3 WAI 4 WAI 5 WAI 6 WAI 7 WAI 8 WAI 1 TME3 0.00 c 1.25 b 1.50 b 2.00 c 2.00 c 2.00 c 2.00 c 2 Rayong11 2.00 a 4.00 a 4.00 a 4.00 a 4.00 a 4.00 a 4.00 a 3 CMR-89 1.00 b 1.75 b 2.50 b 3.25 ab 3.25 ab 3.25 b 3.25 b 4 Kasetsart 50 1.00 b 2.00 b 2.50 b 2.75 bc 2.75 bc 3.00 b 3.00 b 5 Huay Bong 60 1.00 b 1.75 b 2.25 b 2.50 bc 2.75 bc 3.00 b 3.00 b 6 Huay Bong 80 1.25 b 2.00 b 2.00 b 2.25 bc 2.50 bc 3.00 b 3.00 b 7 Huay Bong 90 1.00 b 1.00 b 2.25 b 2.25 bc 2.75 bc 2.75 b 2.75 b Tukeys's Honest Significant Difference (HSD) Test * P value (α)= 0.05 Severity of Sri Lankan cassava mosaic disease (SLCMD) on 7 cultivar of cassava 2-8 weeks after inoculation (WAI)
  • 15. Development of disease symptoms on the leaf of cassava plants after grafting inoculation Progress in disease incidence in 6 week old plants of CMR-89 after grafting inoculation with TME3, Rayong11, CRM-89, Kasetsart 50, Huay Bong 60, Huay Bong 80 and Huay Bong 90. Data shown at the average of five replications. 15
  • 16. CMD-resistant cassava cultivars from IITA Nov 2018 TME B419 IITA-TMS-IBA980581 IITA-TMS-IBA980505 IITA-TMS-IBA972205 IITA-TMS-IBA920057 16
  • 17. 17 Micropropagation of CMD cassava varieties
  • 18. Transplantation of TC CMD seedlings at TDI Clone Tissue culture seedlings (Sep 2018 - May 2019) Transplanting period Survival rate of transplants after planting 1 month C33 6,384 June-Sep 2019 100% TME-3 8,428 June-Sep 2019 100% 18 1 month 2 months 3 months
  • 19. TME3 and C33 are planting for general yield trial in 3 locations comparing with commercial varieties Suwan Farm field trial TDI field trial Khao Hin Sorn field trial 19
  • 20. TME3 and C33 are planting for general yield trial in spreading CMD field 20
  • 21. Flower induction experiment @ TDI, Pruning technique 21
  • 22. Flower induction experiment @ TDI, Huay Bong, Nakorn Rachasrima (The North-Eastern part of Thailand) 323 meters above sea level Three-month old Rayong 72 flowering at the first fork branching Three-month old TME3 (left) and C33 (right) had the first forking. Varieties Red light No red light KU50 - - HB80 Forking Forking HB90 - - R5 Forking Forking R9 - - R72 Forking Forking TME3 Forking Forking C33 Forking Forking 22
  • 23. Two-month old Rayong 5 flowering at the first fork branching Varieties Red light No red light KU50 - - HB80 flowering Flowering HB90 - - R5 flowering flowering R9 - - R72 - - Flower induction experiment @ Doi Pui Hill, Chiang Mai (The Northern part of Thailand) 1,260 meters above sea level 23
  • 24. Botanical seed to be imported from Hawaii All seeds are open pollinated, we only know about the female progenitor. 24
  • 25. Development of early generation inbred line (EGIL) in Cassava 25 S1 and S2 in Cassava • Developed from KU50 R5 R1 • Selected ~ 500 S1 and S1 lines got 51 potential lines for good yield • Will using the potential lines for using as parents to develop resistant lines for CMD resistant varieties
  • 26. 26 Proposed scheme for fast track introgression of CMD2 into SE Asian cassava breeding populations and rapid breaking of undesirable linkages