MRSA

Methicillin Resistant Staphylococcus aureus
(MRSA):
An evaluation of phenotypic and molecular methods
for detection of MRSA
By
Alaa H. Al-Charrakh
Ph.D Microbial Biotechnology
Babylon University, Iraq
Habeeb S. Naher Anmar H. Al-Fu'adi
Ph.D Bacteriology B.Sc. M.Sc Microbiology

Dedication
To…
All martyrs and Iraqi peoples who died or vanished during
violence waves that devastated Iraq in the last few years.
We dedicate this work
Authors

Acknowledgements
All the praises and thanks are for the most merciful and most
compassionate Al-mighty ALLAH, who is entire source of all the
knowledge and wisdom to mankind. It is He, who blessed one the
courage, ability and sufficient opportunity to complete this task.
The authors would like to thank college of medicine, Babylon
university and the staff of Microbiology department for their support and
cooperation. Our thanks are also extended to the staff of bacteriology lab
in Al-Diwaniya general hospital, and Maternity and Children Hospital.
Also we would like to thank the staff of the Microbiology department,
college of medicine, Al-Qadisiya University. Greatly we would like to
thank the staff of the Microbiology department in college of medicine,
Kufa University: Dr. Ali M. Al-Muhana, Zainab, and Me'aad who never
saved any effort to help me in the completing of this work. We also
would like to thank the staff of the biotechnology institute: Dr. Belal,
Anas, Noor, in the University of Al-Nahrain for their great cooperation.
Authors

Summary:-
A total of 139 swabs from different clinical sites were taken from
patients (aged between 2 days to 65 years) who admitted to several health
centers in Al-Dewaniya city (general teaching hospital, maternity and
pediatrics teaching hospital, Al-Talee'aa primary health center, and general
health laboratory) during a period extending from 1 April to 30 August
2009. The swabs were collected from different clinical sites which include
burns, boils, urine, blood, seminal fluid, drainage of perforated appendix
abscess, drainage of osteomyelitis abscess, vagina, nails, hair, ears, nose,
and wounds.
A total of 148 bacterial isolates represented by different Gram- positive
and Gram-negative bacteria in a percentage of (77%) and (23%)
respectively. Out of these bacterial isolates, 100 isolates (67.57%) were
Staphyllcoccus spp., which constitute for 87.7% of all Gram-positive
bacterial species.
In this study the overwhelming existence of Staphylococcus species
isolates was in urine and boils specimens. They accounted for (72.72%)
and (86.95%) respectively among other types of bacteria in these specimens.
The high frequency of Staphylococcus species in urine and S. aureus in
boils might be due to the fact that Staphylococcus species are commensals
of mucosal surfaces of urogenital tract, and S. aureus frequent
commensal bacteria on the human skin and mucous surfaces.
Only 31 (31%) isolates were belonged to Staphylococcus aureus. Other
Staphylococcus species constituted (69%) and represented by S. epidermidis
(37%), S. saprophyticus (10%) S. haemolyticus (6%), S. xylosus (6%),
S. hominis (5%), S. capitis ( 4%), and S. auricularis (1%).

Screening for β-lactam resistance was performed for all isolates of
S. aureus. The results showed that all isolates were resistant to both
ampicillin and amoxicillin.
The susceptibility to 20 antibiotics were tested by using disk diffusion
test. Ten (32.2%) isolates of S.aureus were identified as MRSA as they
were resistant to both oxacillin and cefoxitin.
The study showed that MRSA isolates were resistant to most β-lactam
antibiotics, but they were highly sensitive to vancomycin, doxycycline,
nitrofuration, imipenem, meropenem and rifampin.
Two-fold agar dilution susceptibility method was performed for the
isolates that showed resistance for both oxacillin and cefoxitin in DD test.
All these isolates showed resistance to oxacillin (4-32 µg/ml).
Results also revealed that MRSA isolates were 8.16% of all Urine
samples, and they were 19.35% of all clinical isolates of skin and skin
structure infections.
Plasmid echelon to ten S. aureus isolates have been studied. Five of
them were oxacillin and cefoxitin resistant isolates that considered MDR-
MRSA and the others were feeble S. aureus isolates. Results of gel
electrophoresis showed two symmetrical plasmid bands for each MDR-
MRSA isolate, these isolates have been studied to identify the presence of
mecA gene.
PCR assay were performed to identify the presence of mecA gene. All
MDR-MRSA isolate showed amplificated bands that corresponding with
control positive mecA gene in gel electrophoresis. While feeble S. aureus
isolates showed no mecA pattern in gel electrophoresis.
Assessing reliability representing by Sensitivity and Specificity of the
results were calculated and showed high Sensitivity and Specificity (100%)
between phenotyping and genotyping tests in the detection of MRSA
isolates. These results reveled that there is no significant difference between
phenotypic and genotypic test in the reference to detection of MRSA
isolates.

List of contents
a
List of contents I
List of tables VII
List of figures VIII
Abbreviations IX
Contents
Chapter one Introduction and Literatures review
Item No. Subject Page
1.1. Introduction 1
1.2. Literatures review 2
1.2.1. Classification and Natural Habitat 2
1.2.2. Characteristics of Staphylococci 3
1.2.2.1. Over view 3
1.2.2.2. Cultural specifications 4
1.2.2.3. Physiological specifications 4
1.2.2.4. Biochemical specifications 5
1.2.3. Virulence factors of S. aureus 4
1.2.3.1. Extracellular toxins and enzymes 5
1.2.3.1.1. Coagulase 5
1.2.3.1.2. α-toxin 5
1.2.3.1.3. Exfoliatins 5
1.2.3.1.4. Food poisoning enterotoxins 5
1.2.3.1.5. Toxic shock syndrome toxin-1 (TSST-1) 6
1.2.3.1.6. Leukocidin 6
1.2.4. Pathogenicity of S. aureus 6
1.2.4. 1. Toxic Shock Syndrome 7
1.2.5. Diagnosis of S. aureus 8
1.2.5.1. Quick Tests 8
1.2.5.2. Conventional Methods 8

List of contents
b
1.2.5.3. Identification Strips 9
1.2.5.4. Automated Methods 10
1.2.5.5. Molecular Methods 10
1.2.6. Epidemiology of S. aureus 10
1.2.7. Antibiotics resistance of S. aureus 10
1.2.7.1. Resistance to β-lactam antibiotics 12
1.2.7.2. Methicillin Resistant Staphylococcus aureus (MRSA) 13
1.2.7.2.1. History of MRSA 13
1.2.7.2.2. Epidemiology of MRSA 13
1.2.7.2.3. Resistance of MRSA to the antibiotics 15
1.2.7.2.4. Treatment of MRSA 16
1.2.7.2.5. Laboratory diagnosis of MRSA 17
1.2.7.2.5.1. Phenotypic methods 18
1.2.7.2.5.1.1. Disk Diffusion Test (DD test) 18
1.2.7.2.5.1.2. Minimum Inhibitory Concentration(MIC) 18
1.2.7.2.5.1.3. BD Phoenix System 18
1.2.7.2.5.1.4. Epsilometer test (E-test) method 19
1.2.7.2.5.1.5. Agar Screening Method 19
1.2.7.2.5.1.6. Latex agglutination test 20
1.2.7.2.5.1.7. Genetic methods 20
Chapter two Materials and Methods
2.1. Materials 22
2.1.1. Samples 22
2.1.2. Laboratory equipments and apparatuses 22
2.1.3. Chemicals 24
2.1.4. Culture media 25
2.1.5. Commercial kits 25

List of contents
c
2.1.6. Antibiotic disks 27
2.1.7. Antibiotics powder 27
2.2. Methods 28
2.2.1. Solutions and Reagents 28
2.2.1.1. Phosphate buffer solution (PBS) 28
2.2.1.2. Urea solution 28
2.2.1.3. Oxidase Reagent 28
2.2.1.4. Catalase Reagent 28
2.2.1.5. Methyl Red Reagent 28
2.2.1.6. Barritt's Reagent of Voges Proskauer test 28
2.2.1.7. Kovac´s reagent 28
2.2.2. Solutions used in DNA extraction by salting out method 29
2.2.2.1. Sodium chloride(NaCl) 5 mol 29
2.2.2.2. SDS Solution 29
2.2.2.3. Phenol solution 29
2.2.2.4. Chloroform: isoamyalcohol 29
2.2.2.5. Phenol:chloroform: isoamyalcohol 29
2.2.2.6. Tris EDTA Buffer (TE buffer) 29
2.2.2.7. Saline - tris –EDTA (STE) 30
2.2.2.8. Lysozyme solution 30
2.2.2.9. Lysostaphin solution 30
2.2.3. Solutions Used in electrophoresis 30
2.2.3.1. Ethidium Bromide Solution 30
2.2.3.2. Tris-Borate-EDTA Buffer (TBE) 30
2.2.3.3. DNA Loading Buffer 30
2.2.3.4. Preparation of agarose gel 30
2.2.4. Preparation of culture media 31
2.2.4.1. Blood agar medium 31

List of contents
d
2.2.4.2. Urea agar medium 31
2.2.5. Staining 31
2.2.6. Laboratory diagnosis 31
2.2.6.1. Bacterial identification assays 31
2.2.6.1.1. Colonial morphology and microscopic examination 32
2.2.6.1.2. Biochemical Tests 32
2.2.6.1.2.1. Catalase test 32
2.2.6.1.2.2. Oxidase Test 32
2.2.6.1.2.3. Urease Test 32
2.2.6.1.2.4. Indole Test 33
2.2.6.1.2.5. Methyl –Red Test 33
2.2.6.1.2.6. Voges – Proskauer Test 33
2.2.6.1.2.7. Citrate Utilization Test 34
2.2.6.1.2.8. Coagulase Test 34
2.2.6.1.3. API Identification Systems 34
2.2.6.1.4. Rapid slide agglutination test 34
2.2.6.2. Phenotyping assays 35
2.2.6.2.1. Screening for β-lactam resistance 35
2.2.6.2.2. Antibiotics susceptibility testing (AST) 35
2.2.6.2.2.1. Disk diffusion test (DD test) 35
2.2.6.2.2.2. Agar dilution test (MIC test) 36
2.2.6.3. Genotyping assays 38
2.2.6.3.1. DNA extraction 38
2.2.6.3.1.1. Wizard Minipreps DNA kit 38
2.2.6.3.1.2. Salting Out Method 38
2.2.6.3.2. PCR assay 38
2.2.6.3.2.1. Preparing of primers 39
2.2.6.3.2.2. The reaction mixture 39

List of contents
e
2.2.6.3.2.3. Thermal cycling conditions 39
2.2.6.3.2.4. Detection of amplified products by gel electrophoresis 40
2.2.7.
Transporting of samples and Preservation of bacterial
isolates
41
2.2.8. Data analysis 41
2.2.8.1. Displaying data graphically 41
2.2.8.2. Assessing reliability 41
Chapter three Results and discussion
3.1. Isolation of bacteria 43
3.2. Laboratory identification of S. aureus 51
3.3. Primary Screening of β- Lactam Resistant Isolates 56
3.4. Detection of Antibiotic Resistance 57
3.4.1.
Determination of antibiotic susceptibility by disk
diffusion test (DD test)
57
3.4.2. Detection of methicillin resistance S. aureus MRSA 69
3.4.2.1. Disk diffusion test (DD test) 69
3.4.2.2. Minimum inhibitory concentration test (MIC) 69
3.4.3. Incidence and distribution of MRSA 72
3.5. Selection of Isolates for genetic study 75
3.5.1. Selection of Efficient MDR- MRSA 75
3.5.2. Selection of feeble S. aureus 75
3.6. Isolation of Plasmid DNA 77
3.6.1. DNA profile 78
3.6.2. Amplification of mecA gene 80
3.7.
Estimation of specificity and sensitivity of phenotypic
tests
83
4.1. Conclusions 85
4.2. Recommendations 86

List of contents
f
References 87
Appendices
Lists of Tables
Table
No.
Subject Page
2-1 Laboratory equipments and apparatuses 25
2-2 Chemical materials used in the present study 28
2-3 Ready-made culture media 29
2-4 Commercial kits used in the present system 29
2-5 Antibiotic disks 31
2-6 Antibiotic powder 31
2-7
The concentrations and dilutions for Agar dilution test
(MIC test)
42
2-8 Contents of the reaction mixture 45
2-9 The cycling conditions 46
3-1
Distribution of other bacterial isolates than
Staphylococcus spp. among clinical specimens
52
3-2
Shows the distribution of staphylococcus species among
clinical samples
56
3-3
Biochemical and physiological characteristics of
Staphylococcus spp. isolates
60
3-4 Resistance of MRSA isolates toward Cephalosporin 68
3-5 Resistance of MRSA isolates to the antibiotics 71
3-6 MIC of methicillin resistant S. aureus isolates 80
3-7 Percentages of MRSA isolates among clinical specimens 83
3-8 Phenotypic characteristics of MDR-MRSA 91
3-9
Sensitivity and specificity estimating with gold standard
PCR (detection of mecA gene) and Both oxacillin (MIC,
and DD tests) and cefoxitin (DD tests)
94
List of Figures
Figure No. Subject Page
1-1
Schematic diagram for identification of S. aureus and
some other Stapylococcus spp.
10
3-1 Percentages of positive and negative growth cultures 49
3-2 Percentages of single pathogens and mix growth 49

List of contents
g
3-3 Percentage between Gram +ve and Gram -ve bacteria 50
3-4 Percentages of Staph. spp. and other bacteria 53
3-5 Percentages of Staph. spp. and other Gram +ve pathogens 53
3-6
Percentages of Staph. spp. isolates recovered from
clinical specimens
55
3 -7 Mannitol fermentation by staphylococcal spp. 59
3-8 Free (extracellular) coagulase 61
3-9 API Staph identification system 62
3-10 Rapid agglutination test that detect the production 63
3-11
Screening of β- Lactam resistant S. aureus isolates using
pick and patch technique 64
3-12
The percentages of resistance to the antibiotics among
Staphylococcus aureus isolates
67
3-13
Percentage of oxacillin resistance isolates of S. aureus in
the present study
82
3 -14
Percentage of Staphylococcus aureus that selected for
mecA secreening by PCR and their resistance to the
antibiotics
87
3-15
Agarose gel electrophoresis of plasmid profiles of
S.aureus isolates obtained from clinical samples 89
3-16
Agarose gel electrophoresis of mecA gene amplification
of MDR-MRSA isolates by PCR that obtained from
clinical samples
92
Abbreviations
Abbreviatio
ns
Key
MRSA Methicillin resistant Staphylococcus aureus
CLSI Clinical and Laboratory Standards Institute
PBP Penicillin-binding protein
mecA Methicillin resistant gene
MIC Minimum inhibitory concentration
PCR Polymerase chain reaction
β Beta
UV Ultraviolet
CFA/I Colonization Factor Antigen-I

List of contents
h
CFA/III Colonization Factor Antigen-III
Fc Crystallizable fragment of an antibody
fnb Genes encoding for fibronection-binding proteins
CA-MRSA Community-acquired MRSA
HA-MRSA Hospital-acquired MRSA
PVL Panton–Valentine Leukocidin
CoNS Coagulase-negative Staphylococci
RT-PCR Real-time PCR
aacA, aphD,
aadD
Aminoglycoside resistant genes
SCCmec Staphylococcal Cassette Chromosome mec
NNIS National Nosocomial Infections Surveillance
tetM Tetracycline resistant gene
DD test Disk Diffusion test
FDA Food and drug administration
E-test Epsilometer test
NCCLS National committee for clinical laboratory standards
DIG Digoxigenin
DNA Deoxyribonucleic Acid
ITS Internal transcribed spacer
EDTA Ethylenediaminetetra acetic acid
M Methicillin
Va Vancomycin
OX Oxacillin
FOX Cefoxitin
IPM Imipenem
MEM Meropenem
KF 1st.Cephalothin
CAZ 3rd. Ceftazidime

List of contents
i
CRO 3rd. Ceftriaxone
CTX 3rd. Cefotaxime
FEP 4th. Cefepime
CIP Ciprofloxacin
AM Ampicillin
AMC Amoxicillin /clavulanic acid
TE Tetracycline
DO Doxycycline
K Kanamycin
RA Rifampin
AZM Azithromycin
F Nitrofurantion 300
mcg Microgram
PBS Phosphate buffer solution
TE buffer Tris- EDTA buffer
SDS Sodium dodecyl Sulfate
TBE Tris-Borate-EDTA buffer
mM Mill mole
STE Saline - Tris –EDTA
MR – VP Methyl red – Voges Proskauer
AST Antibiotics susceptibility testing
BHI Brain heart infusion broth
UTI Urinary tract infection
MSCRAMM
s
Microbial surface components recognizing adhesive matrix
molecules
PIA Polysaccharide intercellular adhesion
PNAG Poly- N - acetylglucosamine
MDR Multidrug resistant
ant(4') Gene encoding for aminoglycoside nucleotidyltransferase

List of contents
j
ANT Aminoglycoside nucleotidyltransferase
pUB110
plasmid carrying kanamycin and neomycin resistance genes in
MRSA
msrA
A gene encoding for MsrA protein that induced by
clarithromycin, azithromycin, and telithromycin,
tet gene
A gene encoding for Tet protein which responsible for protecting
the ribosome against tetracyclines
VISA Vancomycin intermediate resistant S. aureus
VRSA Vancomycin resistant S. aureus
Van(A, B,
C1, C2, C3)
Genes responsible for glycopeptide resistance
VRE Vancomycin-resistant enterococci
b.p Break point
SSTIs Skin and soft tissue infections
SSI Surgical Site Infection
CDC Center for disease control and prevention
MSSA Methicillin-sensitive S. aureus
NC Negative control
PC Positive control
rRNA Ribosomal ribonucleic acid
tRNA Transfer ribonucleic acid
WHO World health organization
CSF Cerebral spinal fluid

Chapter one Introduction and literatures Review
1
1.1. Introduction:-
Staphylococcus aureus frequently produces an enzyme known as β-lactamase
which makes the organism resistant to certain antibiotics that contain a beta-lactam
ring structure such as penicillins. Methicillin resistant Staphylococcus aureus
(MRSA) is a particularly difficult problem (Ravel, 1995). Methicillin-resistant strains
of S. aureus pose an important problem in hospitals, nursing homes, and other health
care settings. Serious infections due to these organisms currently necessitate use of
non-β-lactam antibacterial therapy (Hackbarth, and Chambers, 1989). For this reason,
accurate detection of methicillin or oxacillin resistance among staphylococci is of
great importance, consequently several techniques have been applied to this task,
including agar plate screening, and disk diffusion tests (CLSI, 2007).
Virtually all MRSA produce an additional penicillin-binding protein, PBP2A or
PBP2'(Hartman,1984; Reynolds,1985), which confers resistance to all currently
available β-lactam agents. PBP2A is encoded by the mecA gene (Matsuhashi et
al.,1986). All cells in culture may carry the genetic information for resistance but a
small numbers can express this kind of resistance in routine susceptibility testing
performed in the laboratory. This phenomenon is termed heterogeneous resistance
and occurs in staphylococci resistant to penicillinase-stable penicillin such as
oxacillin(Cavassini et al., 1999). mecA is an additional gene found in methicillin–
resistant staphylococci and with no allelic equivalent in methicillin–susceptible
staphylococci. (Brown, 2001; Tokue et al.,1992; Louie et al., 2000).
There are many laboratory methods for detection of methicillin resistance in S.
aureus. The gold standard, for antimicrobial susceptibility testing has been the
minimum inhibitory concentration (MIC) determined by a dilution or Epcelometric
test method. In recent years MIC methods has been replaced by molecular methods
that detect mecA gene. However, the use of these assay is largely restricted to
reference centers, and they are not currently available in most routine diagnostic
laboratories (Brown, 2001; Louie et al., 2000; Brown et al., 2005).

2
There are several additional genes that affect the expression of methicillin
resistance in S. aureus, but these are found in susceptible as well as resistant strains,
additional genes, which are also found in susceptible isolates, can affect the
expression of methicillin resistance in S. aureus, resulting in heterogeneity of
resistance and making detection of resistance difficult( de Lencastre,1994; Montanari
et al.,1990).
The objectives of this work are:
(1) Comparing several methods, including traditional and commercial methods for
the detection of methicillin resistance in S. aureus with reference to the presence of
mecA gene as the standard.
(2) Study the plasmid profile of both oxacillin and cefoxitin resistance S.aureus .
(3) Detecting the presence of mecA gene by polymerase chain reaction(PCR) as gold
standard to confirm the phenotyping tests of isolates, by which determine the
sensitivity and specificity of the later test.
(4) Detection the degrees of resistance toward the antibiotics among all
Staphylococcus aureus isolates, especially MRSA.
(5) Detecting the most appropriate antibiotic which gives an idea about susceptibility
of MRSA infections to the treatment .
(6) Looking for the most Staphylococcal species that could be recovered from the
clinical samples.
(7) Detecting the frequency of MRSA occurrence among the collected specimens.
1.2. Literatures review
1.2.1. Classification and Natural Habitat:
The genus Staphylococcus is in the bacterial family Staphylococcaceae, which
includes the lesser known genera Gemella, Jeotgalicoccus, Micrococcus, and
Salinicoccus (Garrity and Holt, 2001).Thirty-six species and eighteen subspecies of
the genus Staphylococcus are distinguished based on biochemical analysis and DNA-
DNA hybridization studies (Giesbrecht et al.,1992; Kloos; Bannerman,1992).Various
species are often distinguished as coagulase-positive and -negative, and novobiocin

3
susceptible or resistant(Gotz et al., 2006). Recently, DSMZ, (2004) documented 52
species related to the genus Staphylococcus.
Members of the genus Staphylococcus inhabit the skin, skin glands, and mucous
membranes of humans, animals, and birds. Staphylococci found on the skin are either
resident or transient member of the natural flora. Transient bacteria are encountered
upon exposure with exogenous source and upon contact between different host
species. Such transient organisms are eliminated unless the normal defense barriers of
the host are compromised.
S. epidermidis is the most prevalent and persistent Staphylococcus species on
human skin. Although it is present all over the body surface, it prefers moistured sites
such as the anterior nares and apocrine glands. Similarly, S. aureus, S. hominis, and
S. haemolyticus, and to a lesser extent S. warneri, share the same habitat as a result of
its adaptability. S. hominis colonizes drier regions on the human skin. S. aureus is
found in the nares and other anatomical locales of humans. S. aureus can also
colonize domestic animals and birds. S. capitis colonizes the human scalp following
puberty and large populations can be found in areas with numerous sebaceous glands.
S. auricularis demonstrates a strong preference for the adult human external auditory
meatus. Other staphylococci, including S. xylosus, S. saprophyticus, and S. cohnii, are
more prevalent on lower primates and mammals. Interestingly, pigmented S. xylosus
strains are used as fermenting agents in production facilities and the activity of nitrate
reductase contributes to the development of the red color characteristic of dried
sausages or the orange color that coats some cheeses (Kloos and Bannerman,1992).
1.2.2. Characteristics of Staphylococci:
1.2.2.1. Over view:-
Staphylococci are Gram-positive cocci occurring in grape-like clusters (Garrity
et al., 2005). They are aerobic or facultative anaerobes, can grow well on normal
culture medium. The medically important species among staphylococci is
Staphylococcus aureus, since it produces various virulence factors such as exotoxins
, coagulase, alphatoxin, leukocidin, exfoliatins, enterotoxins, and toxic shock toxin

4
(Kayser et al., 2005).It can also produce lipase, protease, hyaluronidase, and DNAse,
which can be leading to tissue damage. Another important enzyme is penicillinase.
(Dufour et al., 2002).
1.2.2.2. Cultural specifications:
S. aureus on blood agar is large, round, tan to yellowish colony surrounded with
a halo clear zone of hemolysis . It is often β-hemolytic on blood agar (Murray et al.,
2003).
1.2.2.3. Physiological specifications:
Staphyllococci are extremely can survive in adverse environment for a very long
time, some strains can even withstand temperature of 60ºC for 30 minutes. As
compared to other bacteria, these are more resistant to the action of
disinfectants(Rajesh and Ichhpujani, 2004), especially S. aureus which can survive at
NaCl concentrations as high as 15 percent (Whitt and Salyers, 2002). However,
approximate Dosage by ultraviolet-light(UV) at 4,500 µW. s/cm2 can Inactivate 90%
of S. aureus (Bitton, 2005).
1.2.2.4. Biochemical specifications:
staphylococci can produce acid from glucose anaerobically (Ravel, 1995). It
can ferment the mannitol and convert the reddish agar to yellow, because phenol red
becomes yellow in the presence of fermentation acids (Prescott, 2002) It is catalase
and coagulase positive (Johnson et al., )2002 .
1.2.3. Virulence factors of S. aureus:
S.aureus is an opportunistic pathogen deploying a range of adhesions, evasions,
and aggressins (Lowy, 1998). The collection of genes expressed during an infection
that is required for the establishment and progression of disease have been termed the
“virulon”. The virulon of S. aureus can be classified as surface factors (involved in
adhesion and immune evasion, e.g., protein A) and secreted factors (toxins and
enzymes involved in damaging the host (El-Sharoud, 2008). In these surface factor
antigens CFA/I , CFA/III, protein A which binds IgG molecules by the Fc region, in
serum, bacteria will bind IgG molecules the wrong way round by non immune

5
mechanism; in principle this will disrupt opsonization and phagocytosis (Al-Saigh,
2005).
One of the most well-characterized colonization factors in S. aureus is the
polypeptides of the antigen I/II family. S.aureus expresses fibronection-binding
adhesions and there are two genes encoding for fibronection-binding proteins have
been identified in S. aureus (fnbA and fnbB), binding activity is critical in
pathogenesis because it allows the bacteria to adhere to extracellular matrix
components including fibronection and collagen by which it can result in cutaneous
infections and in life-threatening bacteremia and endocarditis (Schennings et al.,
1993). The enzymes that catalyzing the reaction of cross-linking the peptidoglycan of
the bacterial cell wall called penicillin binding proteins (PBPs). Binding of PBP to β-
lactam antibiotics inhibits the enzyme activity and prevents bacteria growth by
interfering with cell wall formation in methicillin-susceptible strains, which have
high affinity for most β-lactam antibiotics.
In contrast PBP2A has low affinity for binding β-lactams. In methicillin-resistant
strains, the essential function of PBP is undertaken by PBP2A to maintain survival of
the bacterium in the presence of antimicrobials (Chambers, 2003).
1.2.3.1. Extracellular toxins and enzymes:-
S. aureus secretes numerous enzymes and toxins that determine the pathogenesis
of the attendant infections. The most important of these as stated by (Kayser et al.,
2005; Francisco, 2004) are as follows:
1.2.3.1.1. Coagulase: it is an enzyme that functions like thrombin to convert
fibrinogen into fibrin. Microcolonies surrounded by fibrin walls are difficult to
phagocytose.
1.2.3.1.2. α-toxin : it can have lethal central nerves system effects, damages
membranes and is responsible for a form of dermonecrosis.
1.2.3.1.3. Exfoliatins : it causes what it is called “scalded skin syndrome”.
1.2.3.1.4. Food poisoning enterotoxins : The symptoms can be caused by eight
serologically differentiated enterotoxins (A-E, H, G, and I). These proteins(molecular

6
weight:35kilo Dalton) are not inactivated by heating up to 100°C for 15–30 minutes.
Staphylococcus enterotoxins are referred to as superantigens.
1.2.3.1.5. Toxic shock syndrome toxin-1 (TSST-1) : TSST-1 is a superantigen that
induces clonal expansion of many T- lymphocyte types (about 10%), leading to
massive production of cytokines, which then give rise to the clinical symptoms of
toxic shock.
1.2.3.1.6. Leukocidin : it damages microphages and macrophages by degranulation.
Worthier to be mentioned; community-acquired MRSA (CA-MRSA) appears to have
a distinct exotoxin Panton–Valentine Leukocidin (PVL), which has been associated
with severe infections(Centers for Disease Control, 1999; Baba et al., 2002;
Kazakova et al., 2005). PVL encoding by PVL gene, This gene is found in
methicillin-sensitive S. aureus and clearly predates the development of methicillin
resistance (Nolte et al., 2005).
1.2.4. Pathogenicity of S.aureus:
S. aureus has been a major cause of infections in humans for as long as we have
historical records. Pathological changes consistent with staphylococcal osteomyelitis
are known from Egyptian mummies and remains of similar antiquity (Weigelt, 2007).
S. aureus produces a carotenoid pigment that imparts a golden color to its colonies.
This pigment enhances the pathogenicity of the organism by inactivating the
microbicidal effect of superoxides and reactive oxygen species within neutrophils
(Levinson, 2008). Many infections caused by S. aureus involve the formation of
biofilms; communities of differentiated, surface-adhering bacteria surrounded by an
extracellular matrix (O’Connell et al., 2007).
The carrier state is well documented to be significantly associated with the
development of infections when an injury or skin break occurs. A patient known to
be nasally colonized with S. aureus has a significantly higher risk of developing
staphylococcal wound infection after a surgical procedure than someone who is not
colonized (Herwaldt, 2003). S. aureus was thought to be the major cause of
antibiotic-associated enteritis (Ravel, 1995).

7
Strains of staphylococci may produce toxins that can cause three important
entities: (1)scalded skin syndrome” in children (2) toxic shock syndrome in adults
(3)enterotoxin food poisoning. (Tierney et al, 2006). From endocarditis patients S.
aureus is the most common organism isolated (Tintinalli et al., 2003). Also it was
one of the most common organisms isolated from cases of acute post-operative
endophthalmitis (Speaker et al. 1991).
Furthermore; S. aureus can cause skin and soft tissue infections, bone, joint
infections, respiratory infections(including pneumonia),and bacteremia(Dale et al,
2005). Hyperimmunoglobulin E syndrome also known as Job’s syndrome because of
recurrent staphylococcal abscesses, it is autosomal recessive inheritance, associated
with atopic dermatitis and autoimmune phenomena (Provan et al., 2004). In many
cases, being aware of the clinical manifestations and treatment of S. aureus can help
to decrease the incidence of these infections and promote better care for patients who
have been exposed to the pathogen (Weems, 2001).
1.2.4. 1. Toxic Shock Syndrome:
Toxic shock syndrome is characterized by abrupt onset of high fever, vomiting,
and watery diarrhea, sore throat, myalgia, and headache are common. Hypotension
with renal and cardiac failure is associated with a poor outcome. A diffuse macular
erythematous rash and nonpurulent conjunctivitis are common, and desquamation,
especially of palms and soles, is typical during recovery (Tierney et al, 2006 ).
Fatality rates may be as high as 15%. Nonmenstrual cases of toxic shock
syndrome are now about as common as menstrual cases. The syndrome is possible in
any patient with a focus of toxin-producing S. aureus. Organisms from various sites,
including the nasopharynx, bones, vagina, rectum, or from wounds have all been
associated with the illness. Typically, blood cultures are negative because symptoms
are due to the effects of the toxin and need not be due to the invasive properties of the
organism (Tierney et al, 2006 and Henderson, 2006).

8
1.2.5. Diagnosis of S. aureus:
1.2.5.1. Quick Tests:
The most common quick test employed to help identify colonies of
Staphylococcus aureus is the catalase test. This simple and an invaluable test can
differentiate Staphylococcus from Streptococcus. The oxidase test is another quick
test that can differentiate Staphylococcus from Micrococcus. There are a multitude of
latex agglutination tests available (Slidex Staph, bioMerieux) for the identification of
S.aureus. In addition, there are a few kits that utilize passive hemagglutination for the
identification of S. aureus, such as Staphyslide (bioMerieux) (Forbes et al., 2002
;Personne et al.,1997).
1.2.5.2. Conventional Methods:
S. aureus can further be identified by its ability to produce DNase and ferment
mannitol. Both DNase agar and Mannitol Salt agar are readily available (Hansen-
Gahrn et al.,1987). In view of the importance of the coagulase test in the
identification of S. aureus. exists in two forms: bound coagulase or clumping factor,
which is demonstrated in the slide test, and free coagulase, which is demonstrated in
the tube test (Vandepitte et al., 2003).
When needed to specify coagulase-negative Staphylococci (CoNS), there are a
number of tests that can be employed. Carbohydrate utilization such as sucrose,
xylose, trehalose, fructose, maltose, mannose, and lactose, as well as such tests as
urease, nitrate reduction, and phosphatase, will all aid in the identification of CoNS.
Staphylococcus saphrophyticus is a frequent cause of urinary tract infections and can
be identified by its resistance to novobiocin (Hansen-Gahrn et al.,1987). Below, is a
schematic diagram for identification of S. aureus and some other Staphylococcus spp.
as recommended by Vandepitte et al (2003).

9
Figure (1-1) Schematic diagram for identification of S. aureus and some
other Staphylococcus spp.
1.2.5.3. Identification Strips:
There are a number of manufacturers that have developed identification strips
containing many of the biochemical assays. API ID 32 Staph (bioMerieux) and API
STAPH (bioMerieux) utilize 10 and 19 tests, respectively, on their strips and are
reliable in identifying most strains (Layer et al., 2006).

10
1.2.5.4. Automated Methods:
The Vitek GPI card (bioMerieux), and the Phoenix Automated Microbiology
System Panel (Becton Dickinson) are a few of the more common automated
identification panels for staphylococcus as well as other Gram-positive organisms
(Forbes et al., 2002).
1.2.5.5. Molecular Methods:
Molecular methods have gained widespread popularity in the field of medical
microbiology. One of these methods that have been developed by Roche Molecular
Systems which developed a RT-PCR test for the detection of the mecA gene for use
on its Light Cycler (Chapin and Musgnug, 2003; Shrestha et al., 2005).
1.2.6. Epidemiology of S. aureus:
Soon after birth, 5% of neonates become colonized in the anterior nares with S.
aureus, while in adults, 20% to 45% of normal individuals will carry this organism in
their anterior nares (Herwaldt, 2003). Children mostly at risk of death associated with
bacteremia due to S. aureus were least likely to have clinical features traditionally
associated with this infection (Ladhani et al., 2004). Rates of S. aureus infection have
increased during the past two decades. Bacteremia due to S. aureus has been reported
to be associated with mortality rates of 15%-60% (Cosgrove et al., 2003).
Approximately 20-30 % of the general population are "Staph carriers" (Heyman,
2004). In the United States 20% of community-acquired (CA) and nosocomial
bacteremia are caused by S. aureus (Wagenvoort et al.,1997).Incidence of S. aureus
community-acquired bacteremia in Connecticut was 17/100,000 persons (Morine and
Hadler, 2001).
1.2.7. Antibiotics resistance of S. aureus:
Drug resistance has a considerable impact on patient morbidity and mortality.
Widespread antibiotic use has been largely responsible for the development of
resistant forms of S. aureus (Hogg, 2005). The first comprehensive description and
accurate assessment of the epidemiology of drug-resistant strains of S. aureus was
published in 1969 by Jessen et al., (1969). Previous antimicrobial therapy was

11
associated with infection by a strain of methicillin-resistant Staphylococcus aureus;
MRSA (Chambers, 2001).
The antibiotics of choice for therapy of these infections are penicillinase-
resistant penicillins (Kayser et al., 2005). Antibiotic-resistant bacteria have become a
significant worldwide health concern. Some strains of bacteria (called super bacteria)
are now resistant to most, if not all, of the available antibiotics and threaten to return
health care to a pre-antibiotic era. Understanding how and why bacteria become
resistant to antibiotics may aid treatment, the design of future drugs, and efforts to
prevent other bacterial strains to be resistant to antibiotics (Ness, 2004).
Aminoglycosides interfere with bacterial protein synthesis by acting on the 30S
ribosomal subunit, causing cell death (Mandell, 1982).
The aad gene, derived from S. aureus, encodes 3-(9)-O-aminoglycoside adenylyl
transferase. This enzyme confers resistance to the antibiotics spectinomycin and
streptomycin. The aad gene is under the control of a bacterial promoter, bacteria that
contain the plasmid can be identified by their ability to grow on media containing
spectinomycin or streptomycin (Glazer And Nikaido, 2007). More recently
aminoglycosides, such as amikacin or arbekacin, which are not substrates for a
number of aminoglycoside-modifying enzymes, or which retain their antibacterial
activity after modification, are used to treat infections due to gentamicin-resistant
organisms, including MRSA (Magnet and Blanchar, 2004).
Macrolides inhibit bacterial protein synthesis by binding to the 50S ribosomal
subunit causing an inhibition of translocation of peptidyl tRNA and the initial steps
of 50S subunit assembly. The spectrum of activity of macrolides includes aerobic
Gram-positive bacteria, especially Staphylococcus spp.(Kirst and Sides, 1989).
Macrolides are grouped according to the number of atoms comprising the
lactone ring, the 14-membered ring group includes erythromycin, clarithromycin,
roxithromycin and oleandomycin, whereas the only 15 membered ring is
azithromycin, which is characterized by a higher degree of intracellular accumulation

12
within leukocytes and more potent antibacterial activity against Gram-negative
organisms (Peters et al., 1992).
Clindamycin and lincomycin share a common or overlapping binding site on the
ribosome. A ribosomal mutation makes the ribosome insensitive to clindamycin.
Expression of clindamycin- resistance in Gram-positive cocci may be constitutive or
inducible. Staphylococci can also owe their resistance to clindamycin because of
enzymatic inactivation of the drug, the enzyme production being specified by small
nonconjugative plasmids (Spizek et al., 2004). Resistance of lincosamides by the
products of the linA gene of S. aureus is one of the resistance mechanism in this
bacterium (Matsuoka, 2000).
1.2.7.1. Resistance to β-lactam antibiotics:
β-lactam antibiotics represent more than half of all antibacterial drugs used
therapeutically. Structurally, they comprise of four major groups of compounds:
penams (penicillins and β-lactamase inhibitors), cephems(cephalosporins,
cephamycins, oxacephens, and carbacephems), carbapenems (imipenem,
meropenem), and monobactams (aztreonam). All groups have a common
antibacterial mechanism involving inhibition of various enzymes (such as penicillin-
binding proteins) involved in the synthesis of peptidoglycan. The β-lactam ring can
be opened by bacterial enzymes (β-lactamases); in particular, penicillinase, which
can be produced by staphylococcal strains, renders them to resist penicillin
(Lüllmann et al., 2000).
Penicillinase-Resistant Penicillins are The drugs of choice for treatment of
infections caused by penicillinase-producing staphylococci, they are also effective
against penicillin-sensitive pneumococci and Group A streptococci. For oral use,
cloxacillin or dicloxacillin is preferred; for severe infections, a parenteral formulation
of nafcillin or oxacillin should be used. Methicillin is no longer marketed in the US.
Strains of S. aureus or S. epidermidis that are resistant to these penicillins ("oxacillin-
resistant") are also resistant to cephalosporins, and carbapenems (Abramowicz et al.,
2005).

13
1.2.7.2. Methicillin Resistant Staphylococcus aureus (MRSA):
MRSA is one of the Drug-resistant pathogens of humans (Mulligan et al., 1993).
MRSA produces an alternative penicillin binding protein (PBP2A), which is encoded
by mecA gene carried on the Staphylococcal Cassette Chromosome mec (SCCmec).
Because PBP2A is not inhibited by the antibiotics, the cell continues to produce
peptidoglycan and maintains a stable cell wall (Hardy et al., 2004).
There are six basic described SCCmec types; additional resistance genes may be
present or absent depending on the type. SCCmec is inserted into the S. aureus
chromosome near the origin of replication (Kuroda et al., 2001). Most of antibiotic
resistance is transferred by plasmids, while methicillin resistance is chromosomal
transferred by transduction (Hawley et al., 2002).
1.2.7.2.1. History of MRSA:
The first case of MRSA was reported in 1961(Brown, 2001 and Merlino et al.,
2002). MRSA infections have become increasingly common over the last several
decades and are now present or endemic world wide. In the 1980-1981 outbreak of
community-acquired MRSA infections in Detroit ,approximately two thirds of the
patients affected were injection drug users. MRSA generally remained an uncommon
finding even in hospital settings until the 1990s when there was an explosion in
MRSA prevalence in hospitals where it is now endemic (Johnson et al., 2001).
1.2.7.2.2. Epidemiology of MRSA:
MRSA is the major cause of infections in healthcare institutions (Panlilio et
al.,1992) and more recently in the community (Drews et al., 2006), which is
endemic in many hospitals throughout the world (Neu,1992). MRSA was first
reported in 1961, as mentioned above, two years after the introduction of methicillin
for treatment of penicillin-resistant S. aureus infections (Enright et al., 2002 and
Jevons et al.,1963). MRSA infections have become increasingly common over the
last several decades and are now present or endemic world wide, more recently, an
increasing proportion of MRSA isolates were from hospitalized patients admitted
from the community (Morine and Hadler, 2001).

14
However, the epidemiology of MRSA in outpatient settings has not been fully
described. In particular, knowledge is limited regarding the epidemiology of MRSA
in persons visiting hospital outpatient settings, public or community health centers,
and private physicians’ offices, i.e., settings where most MRSA infections are treated
and the greatest percentage of total antimicrobial use occurs (Burt and Schappert,
2004).
Antibiotic resistance levels vary from country to country. For example, the
percentage of MRSA in UK accounted for 40% of nosocomial S. aureus isolates
causing bacteremia, contrasts sharply with that in Holland, where it is currently very
rare, making up only 1% of S. aureus isolates (Tiemersma et al., 2004). In Holland
most cases are found in people who have recently attended foreign medical
institutions; however, occasional instances have arisen, whereby foreign travel was
not a contributing factor. One such case described an MRSA positive baby that had
never traveled abroad (Voss et al., 2005).
Community-acquired MRSA (CA-MRSA) is an emerging pathogen that is
currently a great public health concern, as the prevalence of CA-MRSA infection is
increasing in many communities. Until the mid-1990s, MRSA was primarily linked
to hospitals and nursing homes and was termed hospital-acquired MRSA (HA-
MRSA) Grundmann et al., 2006). CA-MRSA strains have substantial genetic,
microbiological and clinical differences compared with the HA-MRSA
strains(Vandenesch et al., 2003). It was observed that CA-MRSA strains tended to
remain susceptible to most classes of antibiotic including clindamycin, macrolides,
fluoroquinolones, trimethoprim-sulfamethoxazole and aminoglycosides, resistant
only to the β-lactam in contrast to the multidrug-resistant pattern of HA-MRSA
strains (Herold et al., 1998).
Moreover; HA-MRSA strains cause morbidity and mortality primarily in
hospitalized patients, infection with CA-MRSA strains has caused the deaths of
otherwise healthy individuals(Miller et al., 2005). The prevalence of MRSA strains
has steadily increased in the early to mid-1980s in hospitals in the United States and

15
abroad. National Nosocomial Infections Surveillance (NNIS) data collected by the
Centers for Disease Control indicated that MRSA was limited mainly to relatively
large urban medical centers and that rates were 5% to 10%. Smaller, non-referral
centers were relatively free of MRSA, with prevalence rates well below 5%. By the
1990s, rates among these smaller (<200-bed) community hospitals had increased to
20%, and twice that rate was found in the larger urban centers. More recent
surveillance data from NNIS indicated that rates have continued to rise, with the
prevalence of MRSA isolates from intensive care units approaching 50% by the end
of 1998 unless this upward trend has reversed, the prevalence rate of MRSA in U.S.
hospitals likely has reached 50% (Chambers, 2001). Furthermore, Al-Sahllawi,
(2002) found that MRSA isolates exhibited (29.5%) of all S. aureus isolates in local
study carried out in AL-Najaf city/Iraq.
The prevalence of antibiotic resistance among S. aureus strains is a major
problem and MRSA is now the most frequently reported antibiotic-resistant bacteria
in clinical settings in Europe, America, North Africa and the Middle- and Far-East. In
some countries, the MRSA proportion rate in intensive care unit patients is over 60%
(European Antimicrobial Resistance Surveillance System, 2006).
1.2.7.2.3. Resistant of MRSA to the antibiotics:
Staphylococci are carried by healthy people in a variety of body sites without
disease being present. Most people do not get sick from staphylococcal bacteria, even
MRSA(Infectious Diseases and Immunization Committee, 1999).
MRSA become increasing singly problematic due to the emergence of resistant
strain (Murray et al., 2003). The overwhelming majority of methicillin-resistant
strains of S. aureus carry the mecA gene, which encodes production of the low-
affinity penicillin-binding protein PBP2A, which is responsible for phenotypic
expression of methicillin resistance (Archer and Pennell,1990).
Although low levels of resistance to methicillin in mecA negative strains of S.
aureus can arise because of hyperproduction of β-lactamase (McDougal and
Thornsberry, 1986) or production of normal penicillin binding proteins with altered

16
binding capacity (Tomasz et al.,1989) It has not been determined that alternatives to
β-lactam therapy are necessary in the treatment of infections caused by such
organisms. The mecA gene is not found in methicillin-susceptible isolates of
staphylococci (Archer and E.Pennell,1990).
MRSA is considered a Multi-antibiotic-resistant bacteria (Weigelt, 2007).
Imipenem, meropenem: broad coverage against most pathogens except methicillin-
resistant staphylococci(Kasper, 2005). The conjugative transposon containing tetM
(tetracycline resistance) has been suggested to pass between Clostridia and
staphylococci (Ito et al., 2003).
More recently introduced aminoglycosides, such as amikacin or arbekacin, which
are not substrates for a number of aminoglycoside-modifying enzymes or which
retain their antibacterial activity after modification are used to treat infections due to
gentamicin-resistant organisms, including MRSA.(Magnet and Blanchard, 2005).
Clindamycin is an effective therapy for community-acquired methicillin resistant S.
aureus, but there is a risk of development of clindamycin resistance during the
treatment of these bacteria (Marcinak and Frank, 2003).
Fluoroquinolones are not active against most methicillin resistant isolates
(Diekema et al., 2001), providing a selective pressure for MRSA. While any
antibacterial agent that is not active against MRSA should increase a patient’s risk for
infection, fluoroquinolones may be particularly likely to do so, since they have
appear to have unique effects on the expression of MRSA resistance determinants
(Venezia et al., 2001).
1.2.7.2.4. Treatment of MRSA:
Mersacidin and actagardin have been described to be very effective in vivo
against systemic staphylococcal infections and the virulent strain S. aureus including
MRSA (Chatterjee et al., 2004). Mupirocin inhibits protein synthesis, and active
against staphylococci. It eradicates nasal carriage of S. aureus, including MRSA
(Kasper, 2005).

17
Infections caused by these strains should be treated with vancomycin, with or
without rifampin and/or gentamicin, or with linezolid; complicated skin and soft
tissue infections may also be treated with daptomycin. Neither ampicillin,
amoxicillin, carbenicillin, piperacillin nor ticarcillin is effective against
penicillinase-producing staphylococci (Abramowicz et al., 2005). A skin and soft
tissue infection study comparing dalbavancin with linezolid showed equivalent
results with 90% of patients in both groups having a successful outcome (Jauregui et
al., 2005).
A report from Japan in 1997 indicated the existence of a strain of
staphylococcus that had become partially resistant to vancomycin. If a strain of
MRSA also becomes resistant to vancomycin, there will be no effective treatment
available against this super bacterium (Ness, 2003), but Oritavancin is a
semisynthetic glycopeptide antibiotic, like vancomycin, that has bactericidal activity
against clinically relevant serious Gram-positive infections, including vancomycin-
resistant staphylococcus and enterococcus (Fetterly et al., 2004).
Dalbavancin, a second-generation lipoglycopeptide agent belonging to the same
class as vancomycin, is remarkable for an extremely long half-life that will allow for
one-weekly intravenous dosing (Lin et al., 2006).
Recently Ceftobiprole, an investigational cephalosporin, is currently in phase III
clinical development. Ceftobiprole is a broad-spectrum cephalosporin with
demonstrated in vitro activity against Gram-positive cocci, including (MRSA),
furthermore; The broad-spectrum activity of ceftobiprole may allow it to be used as
monotherapy in situations where a combination of antibacterials might be required,
Further clinical studies are needed to determine the efficacy and safety of
ceftobiprole and to define its role in patient care (Zhanel et al., 2008).
1.2.7.2.5. Laboratory diagnosis of MRSA:
Regarding to the accurate susceptibility of MRSA towards antibiotics some or
almost all of the following techniques can be used by most laboratories:

18
1.2.7.2.5.1. Phenotypic methods :
1.2.7.2.5.1.1. Disk Diffusion test (DD test):
This test is the common and useful test for evaluating antibiotic susceptibility.
A set of antibiotic-impregnated disks on agar is inoculated with a culture derived
from the specific bacteria to be tested. The susceptibility test detects the type and
amount of antibiotic or chemotherapeutic agent required to inhibit bacteria growth.
Often, culture and susceptibility tests are ordered together. Susceptibility studies also
may be indicated when an established regimen or treatment is to be altered
(Fischbach et al., 2009).
1.2.7.2.5.1.2. Minimum Inhibitory Concentration (MIC):
The minimum inhibitory concentration (MIC) is defined as the lowest antibiotic
concentration at which the microorganism under assessment shows no visible growth
in vitro. The reporting of MICs can provide the clinician with precise information
regarding the infecting bacterium’s degree of antibiotic susceptibility and avoid
antibiotics to which the organism shows resistance (Provan and Krentz, 2002).
Modification of several conventional testing conditions is necessary for MIC
methods to reliably detect methicillin-resistant staphylococci. The modification
includes replacing methicillin with oxacillin because of its high stability at storage
and high sensitivity in detection of heteroresistance, addition of 2% NaCl to the
medium, preparing bacterial suspension by direct colony suspending, maintaining the
incubation temperature of tests at no more than 35◦C, and extending the incubation
time to a full 24 h. (Unal et al., 1994)
1.2.7.2.5.1.3. BD Phoenix System:
The Phoenix is the newest FDA-approved system. Each susceptibility test panel
contains 85 wells with 16 to 25 different antimicrobials in double dilution. Unlike
VITEK, all reported antimicrobial concentrations are included on the panel. The test
panels are manually inoculated with bacterial suspension equivalent to 0.5 McFarland
standard, and the instrument carries out the rest of the steps from incubating the

19
plates, detecting the growth, to reporting MIC and category results. An oxidation
reduction indicated is added to the inoculation broth. Bacterial growth is determined
by monitoring reduction of a modified resazurin indicator. In combination with the
turbidometric growth detection, the system reports the MICs after 6 to 16 h
incubation. The system determines the MICs in the manner similar to the
conventional microbroth dilution method. Only one drug panel is available for either
Gram-positive or Gram-negative organisms. Limited studies find the system effective
in routine susceptibility testing of commonly encountered Gram-positive and Gram-
negative bacteria (Donay et al., 2004).
1.2.7.2.5.1.4. Epsilometer test (E-test) method:
The E-test method gives an MIC result and is affected by test conditions in a
similar way to other MIC and diffusion methods. The test conditions recommended
by the manufacturer are based on providing results comparable with NCCLS methods
and include Muller Hinton agar with 2% NaCl, an inoculums density equivalent to
0.5–1.0 McFarland standards, application of inoculums with a swab and incubation at
35ºC for 24 hrs. Evaluations comparing the E-test with dilution MIC and molecular
methods have generally gives good essential result. (Huang et al.,1993; Novak et al.,
1993;Weller et al., 1997).
1.2.7.2.5.1.5. Agar Screening Method:
Agar-based methods are available for screening of certain resistance mechanisms
(Swenson et al., 2007). The agar screen method uses a certain cutoff concentration of
the antibiotic that is expected to inhibit the growth of normal susceptible strains and
allow resistant phenotypes to grow. The test is performed by inoculating a defined
volume of a suspension of the test strain from a pure culture onto the agar, followed
by incubation for 18 to 24 hrs. Examples of these agar screen methods include the use
of Mueller Hinton agar supplemented with 4% NaCl and 6 μg ml−1
oxacillin to detect
oxacillin resistance in S. aureus (MRSA screen plate). The agar screen plate is
inoculated with a 1μL loop dipped into a bacterial suspension with a turbidity
equivalent to 0.5 McFarland standard. After 24 hr of incubation at 35°C, the

20
appearance of more than one colony is reported as MRSA screen positive and
requires the laboratory to perform a confirmatory test to verify the resistance.
1.2.7.2.5.1.6. Latex agglutination test:
This test is available as a direct method for detecting oxacillin resistance in S.
aureus. A suspension of pure colonies of the test organism is added to latex beads
bound to antibody against the PBP2A antigen (marker for MRSA), and the presence
of agglutination is interpreted as a positive MRSA result (Cavassini et al., 1999).
1.2.7.2.5.1.7. Genetic methods:
The fact that high-level resistance to penicillinase-resistant penicillins is generally
related to the presence of the mecA gene means that a genotypic method for the
detection of mecA allows rapid and unambiguous characterization of this resistance
mechanism. The earliest molecular methods for the detection of mecA relied on
either radiolabeled or digoxigenin (DIG)-labeled DNA probes (Archer and
Pennell,1990).
The non-radioactive DIG-labeled probe performed as well as the radioactive
label, enabling the safer utilization of the test system in a diagnostic laboratory, but
even when used in either a dot blot or colony blot format, DNA probing involves a
number of time consuming manipulations resulting in delayed reporting. These early
probe studies also highlighted occasional discrepancies, in that borderline-resistant
S. aureus isolates with a methicillin MIC of 8 mg/L were sometimes probe-negative,
but produced large amounts of β-lactamase, which accounted for the elevated
methicillin MIC ( Ligozzi et al. , 1991).
PCR-based methods have been used routinely by reference laboratories as their
standard method for detecting the mecA gene( Bignardi et al.,1996). Occasional
susceptible strains carrying a nonfunctional or non-expressed mecA, will also be
detected, but the presence of mecA is generally considered to indicate a potential for
resistance and is used as a marker to identify MRSA. Several molecular techniques
have been developed to detect MRSA carriage and many of these assays are based on
the detection of S. aureus specific genes, specifically the mecA gene, which encodes

21
methicillin (oxacillin) resistance. However, most of these techniques required
isolation of the organism, often involving multiple steps or a delay of up to 18 hours
before strain confirmation.
An FDA approved, PCR commercially available kit will detect MRSA nasal and
groin carriage within three hours with a sensitivity and specificity in the range of 90–
92% (Bishop et al., 2006). A recent real time (1hour) nucleic acid-based PCR targets
MRSA-specific chromosomal sequences in nasal specimens (specificity 98.4%,
positive predictive value of 95.3%, and a sensitivity and negative predictive value of
100%), allowing for rapid detection of MRSA carriers (Huletsky et al., 2005). Real-
time PCR kit which detects a specific sequence within the internal transcribed spacer
(ITS) region of S. aureus, have proved successful (Levi and Towner, 2004).

22
Chapter two: Materials and Methods
2.1. Materials
2.1.1. Samples:
A total of 139 swabs from different clinical sites were taken from patients
(aged between 2 days to 65 years) who admitted to several health centers in Al-
Dewaniya city (general teaching hospital, maternity and pediatrics teaching
hospital, Al-Talea'a primary health center and General health laboratory) during a
period extending from 1st
April to the 30 of August 2009.
2.1.2. Laboratory equipments and apparatuses:
Table (2-1) Laboratory equipments and apparatuses
No. Item Company Origin
1 Hood Prutscher France
2 Incubator
3 Water Bath
4 Oven
Memmert
5 Distillatory GFL
6 Centerfuge Hettich
7 Thermocycler apparatus MWG – Biotech
Germany
8 Vibrator Yamato
9 Autoclave Stermite
10 Light microscope Olympus
11 Digital camera Sony
12 Sensitive electron balance A & D
Japan
13 Refrigerator LG. Koria
14 Gel-Electrophoresis Bio-Red Italy
15 UV-transilluminator MUV Taiwan
16 Screw capped bottles 30 ml. Universal tube Denmark
17 PCR tubes 50µl.
18 DNA tubes 100 µl.
19
Micropipettes 5-50 µl ,100-1000 µl 0.5
– 10 μl
Eppendorf Oxford

23
20 Plastic Test tubes 10ml. AFCO Jordan
21 Petri dishes 9 cm.
Sterilin
22
Glass beakers
20ml.,50ml.,250ml.,500ml.,1000
ml.
23 Spherical flasks 500ml.,1000ml.
24 Conical flasks 250ml.,500ml.
25
Graduated cylinder
250ml.,500ml.,1000ml.
Hysil U.K
26 Glass Test tubes 10ml.,20ml. Hirschmann Germany
27 Inoculating stander loop Himedia India
28 Wooden sticks Supreme China
29 pasture pipette Hirschmann
30 Benson burner
31
Millipore filter
Satorius
membrane
filter Gm ,BH
,W. ,
32 Slides Beroslide
33 Scalped blades Trinon
Germany
34 Latex gloves 8. Unimed K.S.A

24
2.1.3. Chemicals :
The chemical materials used in this study are shown in Table (2.5).
Table (2-2) Chemical materials used in the present study
Company/ OriginMaterialsNo;
K2HPO4, KH2PO4, Na2HPO4, NaCl,
MgSO4,
CaCl2, CuSO4, NH4Cl
1
tetramethyl –ρ- para phenylene –
diamine
dihydrochloride
2
EDTA3
BDH / England.
Tris-(hydroxymethyl)methylamine
(NH2.(CH2OH)3 (Tis-OH)
4
Ethidium bromide5
Sigma /USASterile urea, Methyl red, α-naphthol,
gelatin
6
Sucrose (C12H22O11)7
Difco/USA
Bromophenol blue8
Mast Diagnostic
/USA
Isopropyl alcohol
9
Biomérieux/FranceMcFarland 0.5 standard10
AppliChem
/Germany
Sodium dodecyl sulfate (SDS)
11
FlukaGlycerol (C3H8O3)12
GCC /EnglandPhenol red13
Crescent /KSAGram stain set14
Fluka chemika
/Switzerland
glucose , 99% ethanol alcohol , urea-
solution , kovac,
s reagent
15
Promega/USAAgarose16
IraqH2O2 (3%)17

25
2.1.4. Culture media:
The culture media used in this study are shown in Table (2-3)
Table(2-3) Ready-made culture media
No. Culture media Company Country
1
Blood agar base, Müller-Hinton agar
Nutrient agar ,Mannitol salt agar
Himedia India
2 MacConkey agar
Tulip Diagnostic
Belgium
3
Nutrient broth, agar –agar , Peptone
broth
Oxoid
4
Urea agar base , Simon citrate agar ,
Triple sugar iron agar , Trypticase
soya broth ,MR –VP broth
Diffco-
Michigan
USA
5
Set of Amies medium and Transport
swab
Citotest
China
2.1.5. Commercial kits:
The commercial kits used in the present study are shown in Table (2-4) and its
appendices, as follow:-
Table(2-4) Commercial kits used in the present study
No. Rapid identification system kit Company Country
1 API staph. Kit Biomérieux France
2 Rapid agglutination test Kit MAST
3 DNA execration Kit(1)
4 Green master mix 2X Kit(2)
Promega
5 Primers(3)
with control positive Alpha
U.S.A

26
(1)DNA extraction Kit consist of :-
No; materials
Pellet cells solutions
1 EDTA solution
Lysozyme solution
Lysostaphin solution
Lyses cells solutions
2 Nuclei lyses solution
RNase solution
3 Protein precipitation solution
DNA precipitation alcohols
4 Isopropanol alcohol
Ethanol alcohol
5 DNA rehydration solution
(2) Green master mix consist of :-
materialsNo;
DNA polymerase enzyme (Taq)1
dATP2
dGTP3
dCTP4
dTTP5
MgCl26
PCR loading buffer7
PCR reaction buffer (pH 8.3)8
(3) Primers consist of :-
Oligonucleotide 5´- 3´ Sequence direction
Target
gene
MRS1F TAGAAATGACTGACGTCCG
Upstream
primer
mecA
MRS2R TTGCGATCAATGTTACCGTAG
Downstream
primer
mecA

27
2.1.6. Antibiotic disks (Bioanalyse /Turkey):
Table(2-5) Antibiotic disks
Disc Potency
(mcg per disk)
AntibioticNo.
10Ampicillin1
10Methicillin2
1Oxacillin3
(20/10)Amoxicillin /clavulanic acid4
30Cephalothin5
30Cefoxitin6
30Cefotaxime7
30Ceftazidime8
30Ceftriaxone9
30Cefepime10
10Imipenem11
10Meropenem12
10Vancomycin13
30Kanamycin14
15Azithromycin15
30Tetracycline16
30Doxycycline17
5Ciprofloxacin18
300Nitrofurantion19
5Rifampin20
2.1.7. Antibiotic powder:
Table(2-6) Antibiotic powders
CountryCompanyAntibiotic
Ampicillin
FranceMerck
Amoxicillin
SyriaElsaadOxacillin

28
2.2. Methods:
2.2.1. Solutions and Reagents:
2.2.1.1. Phosphate buffer solution (PBS) (pH=7.3):
Eighteen gm of NaCl, 0.34 gm of KH2 PO4 and 1.12 gm of K2 HPO4 were all
dissolved in 1000 ml of D.W. The pH was adjusted at 7.3, then the solution was
autoclaved. (Forbes et al., 2007).
2.2.1.2. Urea solution (20%):
It was prepared by dissolving 20 gm of urea in small volume of D.W. and completed
up to 100 ml D.W. and then sterilized by Millipore filter paper .It was used in urease test
for detection of urease positive bacteria (MacFaddin, 2000).
2.2.1.3. Oxidase Reagent:
This reagent was prepared directly by dissolving 0.1gm of tetramethyl –ρ-
paraphenylene diamine dihydrochloride in 10 ml of distilled water , to be store in a
dark container. Every time used ,the reagent has been freshly prepared (Forbes et
al., 2007).
2.2.1.4. Catalase Reagent:
This reagent is prepared by adding 3% of (37% w/v) H2O2 to 100 ml of
distilled water, to be stored in a dark container(Forbes et al., 2007).
2.2.1.5. Methyl Red Reagent:
0.1 gm of methyl red was dissolved in 300 ml of 99% ethanol and then, the
volume was completed to 500 ml by distilled water (MacFaddin, 2000 ).
2.2.1.6. Barritt's Reagent of Voges Proskauer test:
A- 5 gm of α -naphthol was dissolved in 100 ml of 99% ethanol alcohol , stored in
a dark container in cool place.
B- 40 gm of KOH was dissolved in 100 ml of distilled water (Collee et al.,1996).
2.2.1.7. Kovac´s reagent:
It was prepared by dissolving 5 gm of (ρ -dimethyl aminobenzaldehyde ) in 75
ml of amyl alcohol , then 25 ml of concentrated HCl was added , this reagent was
used for the detection of indole (MacFaddin, 2000).

29
2.2.2. Solutions used in DNA extraction by salting out method:-
2.2.2.1. Sodium chloride(NaCl) 5 mol:
This solution prepared by dissolving 29.21gm of NaCl in 50 ml of distill water
and the volume completed to 100 ml then sterilized by autoclave (Pospiech and
Neuman, 1995).
2.2.2.2. SDS Solution (25%):
This solution prepared by dissolving 25gm of SDS in 50 ml of distill water and
the volume completed to 100 ml then preserved in the refrigerator at 4ºC (Pospiech
and Neuman, 1995).
2.2.2.3. Phenol solution:
This solution prepared by melting phenol crystals by placing them in the water
bath at 68ºC, then 100 ml transferred into sterilized beaker, then 0.1% of 8-
hydroxyquinilone was added into the beaker, then equivalent volume of 0.5mol Tris-
HCL (pH 8) added to the mixture in room temperature, this mixture mixed well then
leaved until precipitated and separated into two layers, the aqua's layer discharged,
then 0.1 mol of Tris-HCL (pH 8) added, this procedure repeated several times until
the pH reached to 8 . the final product placed in sterile bottle and preserved at 4ºC
(Sambrook and Rusell, 2001).
2.2.2.4. Chloroform: isoamyalcohol: This solution prepared by mixing 240 ml of
chloroform with 10 ml isoamyalcohol (1:24), the solution preserved in dark bottle at
4ºC (Sambrook and Rusell, 2001).
2.2.2.5. Phenol:chloroform: isoamyalcohol:
This solution prepared by mixing 250 ml of phenol with 250 ml
Chloroform:isoamylalcohol (1:24:25), the solution preserved under layer of 0.1 mol
of Tris-HCL in dark bottle at 4ºC (Sambrook and Rusell, 2001).
2.2.2.6. Tris EDTA Buffer (TE buffer):
This buffer was prepared by dissolving 10 mM Tris-HCl, and 1 mM EDTA in 800
ml D.W, the pH was adjusted to 8 and completed to one litter by D.W, then

30
autoclaved at 121˚C for 15 minutes, and stored at 4˚C until used (Sambrook and
Rusell, 2001).
2.2.2.7. Saline -Tris –EDTA (STE):
This buffer was prepared by mixing 10 mM Tris-HCl, and 100 mM NaCl with 1
mM EDTA in 800 ml D.W, the pH was adjusted to 8 and completed to one litter by
D.W, then autoclaved at 121˚C for 15 minutes, and stored at 4˚C until used
(Sambrook and Rusell, 2001).
2.2.2.8. Lysozyme solution:
This solution prepared instantaneously according to the manufacturer's
instructions, by dissolving 0.01gm of lysozyme into 10 ml D.W, then stored at -20˚C
until used (Sambrook and Rusell, 2001).
2.2.2.9. Lysostaphin solution:
This solution prepared instantaneously by dissolving 0.01gm of lysostaphin into
10 ml D.W, then stored at -20˚C until used (Sambrook and Rusell, 2001).
2.2.3. Solutions Used in electrophoresis:
2.2.3.1. Ethidium Bromide Solution:
A stock solution (5 mg/ml) was prepared by dissolving 0.05 gm of ethidium
bromide in 10 ml of D.W and stored in dark reagent bottle (Pospiech and Neuman,
1995).
2.2.3.2. Tris-Borate-EDTA Buffer (TBE) (Sambrook and Rusell, 2001).:
Tris-OH 0.08 M, Boric acid 0.08 M, and EDTA 0.02 M, were added to 800 ml
D.W, the pH was adjusted to 8 and completed to one litter by D.W, then autoclaved
at 121˚C for 15 minutes, and stored at 4˚C until used (Sambrook and Rusell, 2001).
2.2.3.3. DNA Loading Buffer: This buffer was prepared by dissolving 25 mg
Bromophenol blue and 4 mg Sucrose in 10 ml D.W, and stored at 4˚C until used
2.2.3.4. Preparation of agarose gel: The agarose gel was prepared according to the
method of (Sambrook and Rusell, 2001) by which one hundred ml. of 1x TBE buffer
has been taken in a beaker,1gm agarose was added to the buffer, the solution was
heated to boiling (using water bath) until all the gel particles dissolved, the solution

31
was allowed to cool down within 50-60ºC,then mixed with 0.5 μg /ml ethidium
bromide
2.2.4. Preparation of culture media:
The ready-made culture media have been prepared according to the
manufacturer's instructions, and general culture media described below were prepared
using the routine methods. All were used in appropriate experiments:-
2.2.4.1. Blood agar medium:
Blood agar medium was prepared according to manufacturer by dissolving 40 gm
blood agar base in 1000 ml D.W. The medium was autoclaved at 121ºC for 15 min, cold
to 50 Cº and 5% of fresh human blood was added. This medium was used as enrichment
medium for cultivation of the bacterial isolates and to determine their ability of blood
hemolysis (Forbes et al, 2007).
2.2.4.2. Urea agar medium:
It was prepared by adding 10 ml of urea solution (20% sterilized by Millipore
filter paper) in volume of autoclaved urea agar base and completed up to 100 ml and
cooling to 50ºC, the pH was adjusted to 7.1 and the medium was distributed into
sterilized test tubes and allowed to solidify in a slant form. It was used to test the
ability of bacteria to produce urease enzyme (MacFaddin, 2000).
2.2.5. Staining:
Gram stain was used to differentiate Gram-negative from Gram-positive and to
identify the shape and arrangement of bacteria in steps declared by Benson, (2001).
2.2.6. Laboratory diagnosis:
2.2.6.1. Bacterial identification assays:-
According to the diagnostic procedures recommended by Collee and his colleagues
(1996), MacFaddin (2000), Benson (2001), Vandepitte et al.,(2003), and Forbes and his
colleagues (2007). the isolation and identification of G+ve and G-ve bacteria associated
with patients under study were performed as follows:

32
2.2.6.1.1. Colonial morphology and microscopic examination:
By streaking blood agar culture plates, a small inoculums has been spreading
thoroughly and overgrowth by normal flora was avoiding. This has been done readily
by touching the swab to one small area of the plate and using a second, sterile
applicator (or sterile bacteriologic loop) to streak the plate from that area according
to(Jawetz et al., 2007).
A single colony was taken from each primary positive culture and its identification
was depending on the morphology properties (colony size, shape, color and natural of
pigments, translucency, edge, and elevation, and texture). Colonies were investigated by
Gram stain to observe the specific shape, the Gram reaction staining, the cells
arrangement and the specific intracellular compounds. Bacterial isolates were identified
to the level of species using traditional biochemical tests and then confirmed using the
rapid identification systems as recommended by Biomérieux/ France
2.2.6.1.2. Biochemical Tests:
2.2.6.1.2.1. Catalase test:
Catalase is an enzyme that catalyses the release of oxygen from hydrogen
peroxide . A small amount of bacterial growth was transferred by a sterile wooden
stick onto the surface of a clean dry glass slide , one drop of 3% H2O2 was added to it
, the formation of gas bubbles indicated the positive result (Collee et al.,1996 ).
2.2.6.1.2.2. Oxidase Test:
The test depends on the presence of certain bacterial oxidases that would
catalyze the transport of electrons between electron donors in the bacteria and a redox
dye (tetramethyl – ρ-phenylene-diamine dihydrochloride) the dye was reduced to a
deep purple color . A piece of filter paper was saturated in a petri dish with oxidase
reagent ( freshly prepared ) , a small portion of the bacterial colonies was spread on
the filter paper by a wooden stick . When the color of the smear turned from rose to
purple , the oxidase test was positive (Forbes et al., 2007).
2.2.6.1.2.3. Urease Test:

33
The presence of urease enzyme can be tested for by growing the organism in the
presence of urea and testing for alkali (NH3) production by means of a suitable pH
indicator . The urea agar base was sterilized by autoclave , allowed to get cool to 50 o
C , sterile urea solution was then added , a deep slope of the medium was made in a
sterile tubes then inoculated by the bacterial colonies and incubated at 37o
C , and
examined after 4 hours and an overnight incubation , no tube being reported negative
until after 4 days incubation. Urease positive cultures changed the color of the
indicator to purple – pink (Collee et al.,1996 ).
2.2.6.1.2.4. Indole Test:
Some bacteria decompose the amino acid tryptophane , which accumulated in
the medium and tested for by a colorimetric reaction with ρ- dimethylene-
benzaldehyde. 1% of tryptone broth solution was prepared in tube, then it was
sterilized into an autoclave, after that the broth was inoculated by a loopful of 18 hr.
bacterial growth was incubated for 48-72 hours at 37o
C. Indole test was done by
adding 6-8 drops of kovac,
s reagent (p-dimethylaminobenzaldehyde in amyl alcohol)
.The positive reaction was characterized by formation of red – colored ring at the top
of the broth , while formation of yellow – colored ring indicated a negative result
(MacFaddin, 2000 ).
2.2.6.1.2.5. Methyl –Red Test:
This test employed to detect the production of sufficient acid during the
fermentation of glucose that was shown by a change in the color of methyl red
indicator . The test was performed by preparing ( MR – VP broth ) with 5 ml in each
tube . The tubes were inoculated with bacterial colonies , then incubated for 24 hours
at 37o
C . After that 6-8 drops of methyl –red reagent was added . The change of color
to orange- red indicated a positive result (MacFaddin, 2000 ).
2.2.6.1.2.6. Voges – Proskauer Test: This test was used to detect the production of
acetyle methyl carbinol from carbohydrates fermentation , or its reduction products.
It was performed by preparing MR –VP broth 5 ml in each tube, inoculated with
bacteria colony, then followed by incubation for 24 hours at 37o
C , after that 15

34
drops of 5% α - naphthol (reagent A) were added followed by 10 drops of 40% KOH
( reagent B) shaken well and allowed standing up for 15 minutes before considering
the reaction as negative. When positive, the culture turned red at the surface of the
broth and the color spread gradually throughout the tube . The positive result
indicated a partial analysis of glucose which produced acetyl methyl carbinol or its
reduction product (Collee et al.,1996).
2.2.6.1.2.7. Citrate Utilization Test:
After sterilization of Simmon`s citrate medium by autoclaving , the bacterial
colonies were inoculated and incubated for 24 – 48 hours at 37 o
C , the change of the
color of medium from green to blue with streaks of growth indicated positive results,
while unchanged original green color with no growth indicated negative results
(Benson, 2001).
2.2.6.1.2.8. Coagulase Test:
The method of Benson, (2001) was followed with some modifications :
Several colonies of bacteria growth were transferred with a loop to a tube containing
5 ml of brain heart infusion broth. The tube was covered to prevent evaporation and
was incubated at 37°C in the incubator over night. Then the tube mixed and
centrifuged, 0.5 ml of the supernatant withdrawn and mixed with 0.5 ml of rabbit
plasma, then incubated in the water bath at 37°C for several hours. If the plasma
coagulates, the organism is coagulase-positive. Some coagulations occurred in 30
minutes or several hours later. Any degree of coagulation, from a loose clot
suspended in plasma to a solid immovable clot, was considered to be a positive result,
even if it takes 24 hours to occur.
2.2.6.1.3. API Identification Systems:
API staph identification systems assay has been performed according to the
manufacturer's instructions.
2.2.6.1.4. Rapid slide agglutination test:
The procedure encompasses the following steps:-
1- One drop of latex reagent has been added into a circle on the test card.

35
2- By using a clean mixing stick, 2-4 average size colonies picked up from a fresh
overnight culture plate and emulsified in the latex, mixed thoroughly and spread over
half the area of the circle.
3-the card has been rotated and rocked slowly and perused within one minute.
4- A positive result was indicated by visible aggregation of the latex particles with a
clear background, and negative reaction was indicated by a milky appearance without
any visible aggregation of the latex particles.
2.2.6.2. Phenotyping assays:
2.2.6.2.1. Screening for β-lactam resistance (NCCLS, 2003 b):
*Muller-Hinton agar were prepared (as mentioned above) and cooled to 45°C.
*Ampicillin and amoxicillin were added (each alone) ,from stock solution to the
cooled Muller-Hinton agar at final concentration of 100 and 50µg/ml respectively .
The media was poured into sterilized petri dishes that previously divided by wax pen
from the out side into squares including the number of each tested isolate, then stored
at 4°C.
*Preliminary screening of S. aureus isolates resistance to β-lactam antibiotics was
carried out using pick and patch method on the above plates.
*Results were determine according to presence (+ve) or absence (-ve) of colony
patch.
2.2.6.2.2. Antibiotics susceptibility testing (AST):
2.2.6.2.2.1. Disk diffusion test (DD test):
The Kirby-Bauer method is a standardized system that takes all variables into
consideration. It is sanctioned by the U.S. FDA and the Subcommittee on
Antimicrobial Susceptibility Testing of the National Committee for Clinical
Laboratory Standards (Benson, 2001).
1. It was performed by using a pure culture of previously identified bacterial
organism . The inoculum to be used in this test was prepared by adding growth
from 5 isolated colonies grown on blood agar plates to 5 ml of nutrient broth,
this culture was then incubated for 2 hours to produce a bacterial suspension

36
of moderate turbidity that compared with turbidity of ready-made (0.5)
McFarland tube standard provided by Biomérieux/ France. A sterile swap was
used to obtain an inoculum from the standardized culture, this inoculum was
then swapped on Müeller – Hinton plate .
2. The antibiotic discs were placed on the surface of the medium at evenly spared
intervals with flamed forceps, then incubated at 33ºC to 35ºC for a full 24
hours before reading the results to identify cells expressing heteroresistance
(Weigelt, 2007).
3. Antibiotics inhibition zones were measured using a transparent ruler. Zone size
was compared to standard zones recommended by CLSI (2007), to determine
the susceptibility of organism to each antibiotics (MacFaddin, 2000 ).
Antibiotic susceptibility tests of all MRSA isolates were performed using a
disk diffusion method (CLSI, 2007) on Muller- Hinton agar with antibiotic disk
of oxacillin (1 mg) and cefoxitin (30 mg), then interpreted according to (CLSI,
2007) guidelines. Each bacterial isolate were initially considered MRSA, if the
test results of inhibition zones for both oxacillin and cefoxitin were ≤10mm and
≤21mm respectively.
2.2.6.2.2.2. Agar dilution test (MIC test):
The follwing table describe the concentrations and dilutions according to CLSI,
(2007) recommandations:
●The two-fold agar dilution susceptibility method was used for determination of
MICs of oxacillin.
●The ranges of appropriate dilutions of oxacillin for MIC determinations (μg/ml)
was used as described by Miles and Amyes (1996), as 0.25- 128(μg/ml ).
●Appropriate dilutions of oxacillin antibiotic solutions were prepared according to
the report of international collaborative study by Ericsson and Sherris (1971), in
which one part of the oxacillin solution was added to nine parts of liquid Muller-
Hinton agar. The prepared dilutions of oxacillin solutions were added to the molten
Muller- Hinton agar medium supplemented with 2% NaCl (Huang et al., 1993) that

37
have been allowed to equilibrate in a water bath to 45-50°C. The agar and oxacillin
solution were mixed thoroughly and the mixture was poured into petri dishes, The
agar was allowed to solidify at room temperature.
Table(2-7) The concentrations and dilutions for Agar dilution test (MIC test)
●A standardized inoculum for agar dilution method was prepared by growing
bacteria to the turbidity of 0.5 McFarland standard.
●The agar plates were marked for orientation of the inoculum spots.1-μL aliquot of
each inoculum was applied to the agar surface with standardized loop.
●Antibiotic free media were used as negative controls and inoculated. The inoculated
plates were allowed to stand at room temperature ( for no more than 30 min) until the
moisture in the inoculum spots was absorbed by the agar. The plates were inverted
and incubated at 33°C for 16 to 20 hours.
●To determine agar dilution break points, the plates were placed on a dark surface ,
and " the MIC was recorded as the lowest concentration of the antimicrobial agent
that completely inhibits growth (disregarding a single colony or a faint haze caused

38
by the inoculum) or that concentration (μg/ml) at which no more than two colonies
were detected. The MIC values were compared with the break points recommended
by CLSI (2007).
2.2.6.3. Genotyping assays:
2.2.6.3.1. DNA extraction:
Two methods were used to isolation of DNA:
2.2.6.3.1.1. Wizard Minipreps DNA kit (Promega):
DNA purified by using the wizard minipreps DNA kit and according to the
manufacturer's instructions.
2.2.6.3.1.2. Salting Out Method:
This method was prepared according to the Pospiech and Neumann (1995) with
some modification as follows:
Bacterial cells of 50 ml culture were precipitated by centrifugation (1000 rpm for
10 minutes). Rewashed many times (2-3) in TE buffer. Then the pellet was
resuspended in 5 ml TE buffer. An aliquot of 500µl of lysozyme with 500µl of
lysostaphin were added to the bacterial precipitate and mixed gently then incubated
at 37˚C for 1hr . A volume of 600 µl of freshly made 25% SDS was added, mixed by
inversion to the cell suspension, and incubated for 5 minutes at 55˚C. Then 2 ml of 5
M NaCl solution was added to the lysate, mixed thoroughly by inversion, and let to
be cooled to 37˚C. 5 ml of phenol : chloroform : isoamylacohol (25: 24: 1 v/v) was
added to the lysate and mixed by inversion for 30 minutes at 25˚C. It was spun by
centrifuge 4500 rpm at -20 ˚C for 10 minutes. Then the aqueous phase was
transferred to a fresh tube, which contains nucleic acid. Isopropanol (0.6 volume) was
added to the extract and mixed by inversion, after 3 minutes DNA spooled on to a
sealed pasture pipette. DNA rinsed in 5 ml of 70% ethanol, air dried, and dissolved in
1-2 ml TE buffer at 55˚C., then DNA extract was kept in -20˚C until use.
2.2.6.3.2. PCR assay: PCR amplification mixture has been prepared according to the
manufacturer's instructions, by the following steps:

39
2.2.6.3.2.1. Preparation of primers: The lyophilized oligonucleotide upstream and
downstream primers were diluted first in 1 ml of TE (pH 8.0) for each primer, and
kept as stock in -20ºC then 100 µl of upstream and 80 µl of downstream stocks each
were diluted in 1ml of deionized sterile distilled water to obtain nearly 10
picomoles/µl. for upstream primer, and 8 picomoles/µl. for downstream primer.
2.2.6.3.2.2. The reaction mixture:
Enzymatic amplification of DNA was carried out in a final volume of 50 μl
containing the following:-
Table(2-8) Contents of the reaction mixture
No; Contents of the reaction mixture volume
1- Green master mix 25 μl
2- Upstream primer of 10 pmol/ μl 5 μl
3- Downstream primer of 8 pmol/ μl 5 μl
4- DNA template 5 μl
5- Nuclease free water 10 μl
Total volume 50 μl
For each isolate the contents (Table 2-8) except DNA template were assembled in
one microcentrifuge tube (special for PCR reaction) reaching to 45 μl, then 5 μl of
the extracted template DNA added in cooling conditions. The final volume (50 μl)
centrifuged for 5 seconds after thermal cycler step.
2.2.6.3.2.3. Thermal cycling conditions:The reaction was preformed in a PCR
thermal cycler apparatus, and after several trials, the following program was
adopted:
PCR consisted of a preheating at 94ºC for 3 min after this initial denaturation step,
the mixture was subjected to 30 amplification cycles as follows:

40
Table(2-9) The cycling conditions
Loop's steps Temperature Time
Number of
cycles
Initial denaturation 94 ºC 3 min 1
denaturation 94 ºC 1 min
annealing 65 ºC 1 min
extension 72 ºC 1 min
30
Final extension 72 ºC 5 min 1
Hold 4 ºC indefinite 1
2.2.6.3.2.4. Detection of amplified products by agarose gel electrophoresis:
Successful PCR amplification was confirmed by agarose gel electrophoresis
(Sambrook and Russell, 2001). A horizontal slab gel electrophoresis apparatus was
used. The gel was poured into casting tray and the comb was positioned at one end
of the tray, then agarose solution poured into the tray and it was allowed to
intransigence at room temperature for 30 minutes. The comb was carefully removed
and the tray placed in the electrophoresis chamber. The chamber was filled with 0.5
X TBE buffer until the buffer reached 3-5 mm over the surface of the gel. Next,
10μl of amplified products were mixed with 3 μl of loading buffer and injected
inside the wells by using a micropipette, PCR mix without DNA template were
added as a control negative, and PCR mix with DNA of MRSA (providing by the
manufacturer's company) were added as a control positive.
The apparatus then turned on , calibrated at 60V for 30 min. and started. When
the time elapsed, bands visualized by using ultraviolet trans-illuminator, and the
bands that appeared on the gel was photographed as soon as possible by digital
camera.

41
The isolate was considered positive for MRSA when the amplified gene
fragment appeared as shiny band corresponding with control positive band that
detected in the gel (Santos et al., 1999).
Worthily for mentioning, before PCR assay, DNA profile were performed by
using only bacterial DNA and loading buffer without thermal cycling conditions, and
according to the steps that mentioned above.
2.2.7. Transporting of samples and Preservation of bacterial isolates:
Transport swab with Amies semisolid medium have been used to transport the
samples, according to Brooks et al.,(2007) recommendations. The bacterial isolates
were preserved by streaking on nutrient agar (that previously poured in slant inside
plain tubes), then kept at 4ºC. The isolates were maintained monthly during the
period of study by sub-culturing them in new nutrient agar slant. Then the selected
bacterial isolates preserved in brain heart infusion broth(BHI) supplemented with 15%
glycerol, then kept at -20ºC, by which the bacterial isolates preserved for 6-8 months
(Collee et al, 1996).
2.2.8. Data analysis
Data analysis were performed according to (Petrie and Sabin, 2005)
2.2.8.1. Displaying data graphically:
A- Bar or column chart—a separate vertical bar was drawn for each category, its length
being proportional to the percentages in that category.
B- Pie chart—a circular ‘pie’ split into sections, one for each category, so that the area of
each section is proportional to the percentage in that category.
2.2.8.2. Assessing reliability: Sensitivity and Specificity of the results that obtained from
phenotypic tests were calculated in the reference to the presence of mecA gene by PCR
assay (gold standard) by applying the following equations:
Sensitivity = (a / a + c)x 100
a (true positive) = The number of isolates that indicated MRSA in phenotypic tests and
corresponding with gold standard (mecA positive).

42
c (false positive) = The number of isolates that indicated MRSA in phenotypic tests and
disagreed with gold standard (mecA negative).
Specificity = (d / d + b)x 100
d (true negative) = The number of isolates that not indicated MRSA in phenotypic tests
and agreed with gold standard (mecA negative).
b (false negative) = The number of isolates that not indicated MRSA in phenotypic tests
and disagreed with gold standard (mecA positive).

Chapter three Results and Discussion
43
Chapter three: Results and Discussion
3.1. Isolation of bacteria:
In the present study 139 clinical specimens were collected from different
clinical sites. Positive culture was detected in 135 (97%) specimens as shown in
(Figure 3-1). Among them, mix growth was found in 13 of specimens (9.63%),
while 122 (90.37%) was single culture (Figure 3-2).
culture
positive
97%
culture
negative
3%
Figure (3-1) Percentages of positive and negative growth cultures
mixed
growth
9.63%
single
pathogens
90.37%
Figure (3-2) Percentages of single pathogens and mixed growth
Gram
negative
23%
Gram
positive
77%
Figure (3-3) Percentage between Gram +ve and Gram -ve bacteria

44
A total of 148 bacterial isolates represented by different Gram- positive and
Gram-negative bacteria were recovered from different clinical samples in a
percentage of (77%) and (23%) respectively as shown in (Figure 3-3).
Gram-negative bacteria were distributed among most clinical specimens
which included pseudomonas spp.(12.16%), E. coli (6.08%), Proteus
mirabilis (3.38%), Klebsiella pneumoniae (0.68%) and Neisseria gonorrheae
(0.68%), in both single and mix growth (Table 3-1).
Micrococcus spp. was (4.73%), this result was in accordance with the
result that reported by Hasson (2006) who found that Micrococcus spp.
accounted for (3%) of all isolates. Worthily for mentioning, Micrococcus
spp. is regarded as normal inhabitants of human skin and mucous membranes
but some times can be regarded as contaminants in clinical isolates (Gahrn-
Hansen, 1985). It was found that Micrococcus spp. could cause many life-
threatening infections in addition to bacteremia like endocarditis, central
nervous system infection, peritonitis, and pneumonia (Eiff et al., 1995).
Also two isolates of Enterococcus faecalis were found in urine
specimens from two female patients. These bacteria inhabit the
gastrointestinal tract, the oral cavity, and the vagina as normal commensals in
humans. This organism can cause a wide variety of diseases ,infecting the
urinary tract, bloodstream, endocardium, abdomen, biliary tract, burn
wounds, and indwelling foreign devices (Kayaoglu, and D. Orstavik, 2004).
In the present study one isolate of Actinomyces spp. has also been
recovered from pus secreting from wound after foot amputation of diabetes
mellitus patient. This type of bacteria can cause local infection spreads
contiguously in a slow, progressive manner, ignoring tissue planes. In vivo
growth produces clumps called grains or sulfur granules. Central necrosis of
lesions with neutrophils and sulfur granules is virtually diagnostic of
Actinomyces spp. infection (Kasper, et al., 2005).

Table (3-1) Distribution of other bacterial isolates than Staphylococcus spp. among clinical specimens
Percentages
Seminalfluid
Drainagefrom
perforated
appendix
Boil
Contaminated
wound
Sc.abscess
DM.Pt.*
pusbesidefixing
pin
Burn
ostiomylitis
Urine
specimens
Microorganism
12.16%---3-2112--
6.08%-1-2-1--14
3.38%---------5
0.67%---------1
0.67%1---------
Gram negative:
pseudomonas spp.
E.coli
Proteus mirabilis
Klebsiella pneumonia
Neisseria gonorrhoeae
7.43%---31----7
1.35%---------2
0.67%-----1----
Gram positive:
Micrococcus spp.
Enterococcus faecalis
Actinomyces spp.
2.7%--4-------Streptococcus pyogenes
35.13%114814112119TOTAL
*Diabetes mellitus patients.
45

46
Moreover, four Streptococcus pyogenes isolates have been recovered
from boil specimens. Skin infections due to S. pyogenes may be due to
breaks in the skin from wounds or lesions from insect bites. Also, S.
pyogenes associated with a variety of skin problems in children especially
associated with chickenpox. This bacteria may cause impetigo contagiosa, an
extremely contagious skin infections (Ahmed et al., 2007).
In the present study, out of 148 bacterial isolates, 100 isolates (67.57%)
were Staphylococcus spp. (Figure 3-4), these isolates were constitute for
87.7% of all Gram-positive bacterial species (Figure 3-5).
Predominance of Staphylococcus isolates among different Gram +ve and
Gram-ve bacterial isolates may be attributed to their ability to survive in
adverse environments for a very long time and some strains can even
withstand temperature up to 60°C for 30 minutes and survive at NaCl
concentrations as high as 15 percent (Whitt and Salyers, 2002). S .aureus also
able to persist for many weeks in dust (Dale and Park, 2004). As compared
to other bacteria these are more resistant to the action of disinfectants (Rajesh
and Ichhpujani, 2004).They are also resistant to many antibiotics especially
Methicillin (MRSA) which facilitated their widespread in environment
(Mukonyora et al., 1985).
Out of all Staphylococcus species isolates, only 31 (31%) isolates were
belonged to Staphylococcus aureus. This frequency is in accordance with
Wertheim et al., (2005), who stated that approximately 30% of the population
may carry S. aureus.
Other Staphylococcus spp. constituted (69%) and distributed among
various clinical specimens which represented by S. epidermidis (37%), S.
saprophyticus (10%) S. haemolyticus (6%), S. xylosus (6%), S. hominis (5%),
S. capitis ( 4%), and S. auricularis (1%) (Figure 3-6).

47
;; other bacteria
32.43%
Staph spp
67.57%
Figure (3-4) Percentages of Staphylococcus spp. and other bacteria
;;
Staph. spp.
87.7%
,other Gram
v+ bacteria
12.3 %
Figure (3-5) Percentages of Staph. spp. and other Gram +ve pathogens
The occurrence of these species in clinical specimens was also reported by
Kawamura and his coworkers (1998) who found the following
Staphylococcus spp. from human clinical specimens being collected from six
hospitals in Japan: S. epidermidis, S. aureus, S. haemolyticus, S. caprae, S.
simulans, S. hominis , S. capitis, S. saprophyticus in different frequencies.

48
Figure (3-6) Percentages of Staph. spp. Isolates recovered from clinical specimens
In this study the overwhelming existence of Staphylococcus species isolates
was in urine and boils specimens. They accounted for (72.72%) and
(86.95%) respectively among all bacterial isolates (Table 3-2). The high
frequency of Staphylococcus species in urine might be due to the fact that
Gram positive bacteria are commensals of mucosal surfaces of urogenital
tract (Al-Dahmoshi, 2009).
The majority of causative agents in urine was S. epidermidis (23.63%),
and S. saprophyticus (16.36%), which means that coagulase negative
staphylococci (CoNS) accounted about (39.99%)of all pathogenic agents that
recovered from urine specimens. This result was higher in relative with
results being obtained by Guirguitzova et al., (2002) who found that 23% of
urinary tract infections were due to CoNS. Moreover, these are regarded as
common contaminants of skin and urethral meatus, in addition to their ability
to resist antibiotics commonly used in medical therapy (Mogra et al., 1981).

Table (3-2) The distribution of Staphylococcus species among clinical samples
Specimens
Staphylococcus Spp.
Urine
Nailswab
Boil
Burnswab
pusbesidefixing
pin
Sc.abscess
Nasalblisters
Nasalswab
Vaginalswab
CSF
wound
Scalpskinswab
earswab
Blood
Seminalfluid
TOTALand
Percentages
Staphylococcus epidermidis 13 2 - 3 3 - - 1 - - 6 3 3 2 1 37
Staphylococcus aureus 11 - 15 - 1 2 1 - 1 - - - - - - 31
Staphylococcus saprophyticus 9 - - - - - - - - - - - 1 - - 10
Staphylococcus haemolyticus 4 - - - - - 1 - - - - - - 1 - 6
Staphylococcus xylosus - - 5 - - 1 - - - - - - - - - 6
Staphylococcus hominis 3 - - - - - - - - - 2 - - - - 5
Staphylococcus capitis - - - - - - - 3 - 1 - - - - - 4
Staphylococcus auriularis - - - - - - - - - - - - 1 - - 1
TOTAL 40 2 20 3 4 3 2 4 1 1 8 3 5 3 1 100
49

50
These commensals bacteria may have a role as opportunistic pathogens in the
presence of weakened local tissue defenses when immunosuppressive agents
are used, and also the antibiotics had been associated with emergence of
opportunistic infection by microorganisms not previously regarded as
pathogen (El-Shamy,1993). Furthermore, Gupta and his colleagues (2001)
explanation may supporting the results of this study, when they supposed that
over the past decade due to increase using of β-lactam antibiotics, the utility
of this class of antibiotics for treatment of UTIs and chronic prostatitis
decreased due to increasing levels of resistance to β-lactam antibiotics, by
which the opportunistic infections are usually caused by endogenic flora.
S. aureus was the second pathogenic agent in occurrence of urine specimens
which constituted (20%). This can be explained by its ability to adhere to the
epithelium of urogenital tract using teichoic acid and lipoteichoic acid and
capsular material (Gross et al., 2001). Moreover, S. aureus known to form
biofilms on various biomaterials (Gotz, 2002). It can persist in clinical
settings and gain increased resistance to antibacterial agents through biofilm
formation that appears to be a bacterial survival strategy (Donlan and
Costerton 2002; Hall-Stoodley et al., 2004). In general, staphylococcal cells
embedded in a biofilm or in microcolonies are much more persistent in UTIs
(Gotz, 2002).
In the present study the majority of boil infections were caused by S.
aureus (65.21%), and this percentage is relatively similar to the result
obtained by Barry(2001), but it is more than Al-khudheiri (2008) who found
that (42.9%)of skin infections were caused by S. aureus.
This result might be due to the fact that breaks in the skin from wounds,
surgery, or lesions by insect bites may lead for infections of the skin by S.
aureus which may cause impetigo contagions, an extremely contagious skin
infection. Moreover; S. aureus can colonize hair follicles leading to

51
inflammations that can develop into abscesses or even, in extreme cases,
carbuncles (Ahmed et al., 2007).
Staphylococcal infections could be attributed to the attachment of this
bacterium to the matrix proteins in human body. This attachment represents
the first step of biofilm formation. S. epidermidis and S. aureus express
dozens of microbial surface components recognizing adhesive matrix
molecules (MSCRAMMs) that have the capacity to bind to human matrix
proteins such as fibrinogen or fibronectin, and often combine binding
capacity for several different matrix proteins (Patti et al. 1994). Covalent
attachment is catalyzed by a family of enzymes called sortases that link a
conserved motif of the MSCRAMMs to peptidoglycan (Marraffini et al.
2006). The main molecule responsible for intercellular adhesion is the
polysaccharide intercellular adhesion (PIA), which is sometime refers to as
called poly-N-acetylglucosamine (PNAG) according to its chemical
composition (Mack et al., 1996).
3.2. Laboratory identification of S. aureus:
In this study S. aureus isolates were identified by investigation of colonial
morphology on blood agar as smooth, yellow, white or off-white colonies of
1 to 2 mm in diameter. All S. aureus colonies showed β-hemolysis which
was not evident after 24 hr of incubation and required further incubation, due
to the varying degrees of colony size and color that may mimic other Gram-
positive organisms such as streptococci and micrococci (Hedin and Fang,
2005).
Gram staining showed Gram positive cocci arranged in clusters. Biochemical
and physiological characteristics of all isolates showed positive reactions
with catalase, urease production , gelatin liquefaction, Voges proskaeur, and
mannitol fermentation, while oxidase test revealed negative reaction for all
isolates. These characteristics were compared with referential results
recommended by (Goldman, and lorrence, 2009;Tang and Stratton, 2006;

MRSA

Recommended

Recommended

More Related Content

What's hot

What's hot (20)

Similar to MRSA

Similar to MRSA (20)

Recently uploaded

Recently uploaded (20)

MRSA