CRISPR - gene-editing for everyone
•Download as PPTX, PDF•
40 likes•19,660 views
Have you considered that protein over-expression or inefficient mRNA knockdown may be masking physiological effects in your assays? Increasingly scientists are moving to endogenous gene-editing to characterise the function of their genes of interest. Dr Chris Thorne from Cambridge Biotech Horizon Discovery discusses the ground breaking gene-editing technology CRISPR. The simplicity of experimental design has led to rapid adoption of the technology across the scientific community. However, challenges remain. This Slidedeck focuses specifically on implementing CRISPR experiments, and explore a number of key considerations crucial to maximising chances of targeting success, whether your goal is to generate a knock-out or a knock-in. Chris also takes a look at some of the alternative uses of CRISPR, including sgRNA genome wide synthetic lethality screens. The slides aim to support those researchers either planning to or already using CRISPR gene-editing in their lab. Horizon Discovery have also recently launched a program aimed specifically at academic cell biologists to promote the adoption of CRISPR by offering FREE CRISPR Reagents for knock-out cell line generation - more information available here. http://www.horizondiscovery.com/what-we-do/discovery-toolbox/genassist-crispr--raav-genome-editing-tools
Recommended
More Related Content
What's hot
What's hot (20)
Viewers also liked
Viewers also liked (12)
Similar to CRISPR - gene-editing for everyone
Similar to CRISPR - gene-editing for everyone (20)
More from Candy Smellie
More from Candy Smellie (18)
Recently uploaded
Recently uploaded (20)
CRISPR - gene-editing for everyone
- 1. GENASSIST™ CRISPR: Gene editing for everyone. Join the Program Now! Visit www.horizondiscovery.com/guidebook FREE CRISPR Reagents for Knockout Generation
- 2. Our mission “to translate the human genome and accelerate the discovery of personalised medicines” Tailoring the right drugs...to the right patients...at the right time Horizon Discovery Ltd. 7100 Cambridge Research Park, UK 2
- 3. The opportunity: translating genetic information into personalised medicines Information is no longer a bottleneck, emphasis is shifting to the ‘what does it all mean’ Genome editing is enabling the promise of the genomic era to be realized in the form of novel therapeutics and diagnostics It involves the capability to efficiently introduce targeted alterations into any specific gene in living cells 3
- 4. GENESIS™: Comprehensive genome editing Horizon is the only source of rAAV expertise and is uniquely capable of exploiting multiple platforms: CRISPR, ZFNs and rAAV singularly or combined Horizon’s scientists are experts at all forms of gene editing and so have the experience to help guide customers towards the approach that best suits their project rAAV • High precision / low thru-put • Any locus, wide cell tropism • Well validated, KI focus Zinc Fingers • Med precision / med thru-put • Good genome coverage • Well validated / KO Focus CRISPR • New but high potential • Capable of multi-gene targeting • Simple RNA-directed cleavage • Combinable with AAV 4
- 5. Table of Contents The CRISPR/Cas9 gene editing system Using CRISPR to generate knock-outs and knock-ins • Case study: Knock-out of MAPK3 in A375 cells • Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells Key considerations for CRISPR gene editing Other CRISPR applications • Case study: sgRNA library screening CRISPR at developments at Horizon Discovery and beyond
- 6. The CRISPR/Cas9 System RNA-guided platform to introduce either a cut at a specified location in the genome. Short ‘guide’ RNAs with homology to target loci direct a generic nuclease (Cas9) Guide RNA + Cas9 are delivered into the cell Cas9 cleavage is repaired by either NHEJ, or HDR in tandem with a donor High efficiencies of knockout or knock-in
- 7. The CRISPR/Cas9 System Crispr (cr) RNA + trans-activating (tra) crRNA combined = single guide (sg) RNA
- 8. The CRISPR/Cas9 System gRNA target sequence PAM AGCTGGGATCAACTATAGCG CGG
- 9. Cas9 wild-type or Cas9 nickase? Nishimasu et al Cell Cas9 Wild type Cas9 Nickase (Cas9n) Induces double strand break Only “nicks” a single strand Only requires single gRNA Requires two guide RNAs for reasonable activity Concerns about off-target specificity Reduced likelihood of off-target events High efficiency of cleavage Especially good for random indels (= KO) Guide efficiency dictated by efficiency of the weakest gRNA
- 10. Designing a guide RNA Cas9 wild-type: The cut site occurs 3 bp 5’ of the PAM sequence gRNA target sequence PAM AGCTGGGATCAACTATAGCG CGG TCGACCCTAGTTGATATCGC GCC Cas9n (D10a): the single strand nick occurs on the opposite strand gRNA target sequence PAM AGCTGGGATCAACTATAGCG CGG TCGACCCTAGTTGATATCGC GCC
- 11. Designing a guide RNA Ran et al Cell 2014
- 12. Table of Contents The CRISPR/Cas9 gene editing system Using CRISPR to generate knock-outs and knock-ins • Case study: Knock-out of MAPK3 in A375 cells • Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells Key considerations for CRISPR gene editing Other CRISPR applications • Case study: sgRNA library screening CRISPR at developments at Horizon Discovery and beyond
- 13. Using CRISPR to Generate Gene KOs and KIs Case Study: Disruption of the MAPK3 gene in the A375 cell line (copy number = 3) Conserved exon 3 targeted 96 Clones Screened 28 Positive for cutting 7 Clones Sequenced 3 Clones with indels on all three alleles ENSEMBL
- 14. Using CRISPR to Generate Gene KOs and KIs Case Study: Disruption of the MAPK3 gene in the A375 cell line (copy number = 3) 1 2 3 Parental Allele 1 Allele 2 Allele 3
- 15. Using CRISPR to Generate Gene KOs and KIs Case Study: Insertion of the Cas9n gene into a safe harbour locus for constitutive expression 1 2 3 4 THUMPD3 Plasmid donor Cas9n BGH PolyA SV40 NLS hROSA26 locus 635 bp 571 bp
- 16. Using CRISPR to Generate Gene KOs and KIs Case Study: Insertion of the Cas9n gene into a safe harbour locus for constitutive expression Negative control gRNA 1 only gRNA 2 only gRNA 1 and 2 gRNA 1 and 2 + Cas9n 600bp 500bp 400bp 300bp 200bp 100bp Clones Screened 10% Positive for integration All positives contained only a single insertion All positives contained indels in second allele
- 17. On the surface genome editing with CRISPR appears as simple as: Identifying a gRNA target sequence Ordering an oligo with the target sequence and cloning it into a gRNA vector Transfecting cells with the gRNA + Cas9 ... HOWEVER …
- 18. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation
- 19. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation Gene copy number Number and nature of modified alleles Effect of modification on growth Normal human karyotype HeLa cell karyotype
- 20. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation Transfection/electroporation Single-cell dilution Optimal growth conditions
- 21. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation Sequence source Off-target potential Guide proximity Wild-type Cas9 or mutant nickase
- 22. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation Number of gRNAs gRNA activity measurement NT Cas9 wt only gRNA uncut 1 2 3 4 5 600 500 400 300 200 100 +ve 700 700 600 500 400 300 200 100
- 23. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation Donor sequence modifications Modification effects on expression or splicing Donor size Type of donor (AAV, oligo, plasmid) Selection based strategies Cas9 Cut Site Genomic Sequence Donor Sequence containing mutation
- 24. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation Donor sequence modifications Modification effects on expression or splicing Donor size Type of donor (AAV, oligo, plasmid) Selection based strategies (+/+) (KI/KI) (+/-) (KI/-) (-/-) (KI/+)
- 25. Limiting re-cutting by the gRNA can improve the odds (… greatly)
- 26. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation Number of cells to screen Screening strategy Modifications on different alleles Homozygous or heterozygous modifications versus mixed cultures % cells targeted
- 27. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation Confirmatory genotyping strategies Off-target site analysis Genetic drift/stability Modification expression Contamination Heterozygous knock-in Wild type
- 28. Key Considerations For CRISPR Gene Editing Gene Target Specifics Cell Line gRNA Design gRNA Activity Donor Design Screening Validation How many copies? Is it suitable? What’s my goal? (Precision vs Efficiency) Does my guide cut? Have I minimised re-cutting? How many clones to find a positive? Is my engineering as expected?
- 29. Table of Contents The CRISPR/Cas9 gene editing system Using CRISPR to generate knock-outs and knock-ins • Case study: Knock-out of MAPK3 in A375 cells • Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells Key considerations for CRISPR gene editing Other CRISPR applications • Case study: sgRNA library screening CRISPR at developments at Horizon Discovery and beyond
- 30. Other applications of the CRISPR platform (A) Nuclease or Nickase (B) Two nickase complexes can mimic targeted DSBs via cooperative nicks (C) Expression of all components from one plasmid (D) Purified Cas9 protein and in vitro transcribed gRNA can be microinjected into fertilized zygotes (E) Viral vectors encoding CRISPR reagents can be transduced into tissues or cells of interest. (F) Genome-scale functional screening can be facilitated by mass synthesis and delivery of guide RNA libraries. (G) Catalytically dead Cas9 can be fused to functional effectors such as transcriptional activators or epigenetic enzymes. (H) Cas9 coupled to fluorescent reporters facilitates live imaging of DNA loci (I) Inducible reconstituting split fragments of Cas9 confers temporal control of dynamic cellular processes. Hsu et al. Cell. 2014
- 31. sgRNA Screening Lentivirally delivered sgRNA can drive efficient cleavage of target genomic sequences for use in whole genome screens Use massively-parallel next-gen sequencing to assess results Possible addition/replacement to RNAi screens
- 32. 32 sgRNA Screening Shalem et al Science 2014
- 33. Cas9/sgRNA suppresses gene expression far more effectively than shRNA Shalem et al Science 2014
- 34. 34 Synthetic Lethality sgRNA Screening We are integrating CRISPR-based Synthetic Lethality Screens into our platform sgRNA technology will be transformational for both Target ID and early-stage Target Validation
- 35. LentiCRISPR v2 reagents and GeCKO v2 library Due to large vector size, only low titers were achievable with version 1 vectors → large-scale v1 library virus production (and concentration) By vector element clean-up and optimization, v2 vectors produce ~10-fold higher titers Additional two-vector lentiviral system now available for hard-to-infect cell lines Sanjana et al. Nature Methods 2014
- 36. LentiCRISPR v2 reagents and GeCKO v2 library ~120,000 guideRNAs against ~19,000 genes 6 guides vs. each gene in two half-libraries (3 guides/gene in Library A or B) 1000 non-targeting sgRNAs Sanjana et al. Nature Methods 2014
- 37. LentiCRISPR v2 reagents and GeCKO v2 library GeCKO v2 library has now arrived Library amplification + QC Lentivirus production • Determine MOI for GeCKO v2 library lentivirus Two-vector v2 lentiCRISPR system upgraded to include fluorescent tags for rapid hit validation by dual-colour co-culture experiments GFP P2A lentiGuide- Puro_P2A_tGFP RFP P2A lentiGuide- Puro_P2A_tRFP
- 38. Table of Contents The CRISPR/Cas9 gene editing system Using CRISPR to generate knock-outs and knock-ins • Case study: Knock-out of MAPK3 in A375 cells • Case study: Knock-in of Cas9n into safe harbour locus in HEK293T cells Key considerations for CRISPR gene editing Other CRISPR applications • Case study: sgRNA library screening CRISPR at developments at Horizon Discovery and beyond
- 39. Horizons CRISPR developments: Combining rAAV + CRISPR Can we combine technologies for improved efficiency? Tested using a reporter cell-line harbouring an inactivating mutation in GFP Correction donor-vector supplied either as dsPlasmid, ssDNA oligos, or ssDNA rAAV rAAV = the most efficient donor vector (50 fold) % Green cells (FACs)
- 40. Horizons CRISPR developments: Free CRISPR Reagents for Knock-Outs Open to all academic researchers Free guide design using gUIDEbook, Horizon’s in silico guide design software Free cloning 5 guides cloned into all-in-one plasmids that express Cas9 Must let Horizon know when your guide has been used to generate a cell line (feedback on which guide or guides worked) Must license that cell line back to Horizon in return for a royalty Only pay cost of shipping What? Free? WHY?! Strengthen Academic Links Improve gRNA Design Platform Expand Cell Line Repository Horizon would like to license your cell lines!
- 41. GENASSIST: CRISPR and rAAV enabled gene editing Cas9 Vectors • Wild type and nickase • Separate or combined with guide Guide RNA • Single or double guides • Available OTS for in-lab cloning • Custom guide generation available with validation Donors • Available OTS for in-lab cloning • Plasmid or rAAV format • Custom donor generation available Cell Lines • CRISPR-ready cell lines • 550+ OTS cell line menu available for further gene editing Services • Viral encapsulation of rAAV donor • Project design support • On-going expert scientific support
- 42. CRISPR and rAAV Intellectual property It is Horizon's intent to ensure that our customers have a risk free environment to perform and benefit from CRISPR gene editing now and in the future. We bring to our customers the widest breadth of IP available from any commercial source: We currently have either already taken a license to or are in late-stage negotiations to access multiple separate CRISPR IP patent estates Horizon is the only company with access to rAAV as a precise gene editing or DNA/plasmid delivery platform, we are the only company able to offer hybrid rAAV/CRISPR systems that draw from the best aspects of both approaches for far superior gene editing efficiencies.
- 43. Your Horizon Contact: Chris Thorne PhD Gene Editing Community Specialist c.thorne@horizondiscovery.com +44 1223 204799 Horizon Discovery Ltd, 7100 Cambridge Research Park, Waterbeach, Cambridge, CB25 9TL, United Kingdom Tel: +44 (0) 1223 655 580 (Reception / Front desk) Fax: +44 (0) 1223 655 581 Email: info@horizondiscovery.com Web: www.horizondiscovery.com
- 44. Useful Resources From Horizon Free gRNAs in Cas9 wild type vector – www.horizondiscovery.com/guidebook Technical manuals for working with CRISPR - http://www.horizondiscovery.com/talk-to-us/ technical-manuals In the Literature Exploring the importance of offset and overhand for nickase - http://www.cell.com/cell/abstract/S0092-8674(13)01015-5 sgRNA whole genome screening: • Shalem et al - http://www.sciencemag.org/content/343/6166/84.short • Wang et al - http://www.sciencemag.org/content/343/6166/80.abstract On the web Feng Zhang on Game Changing Therapeutic Technology (Link to Feng’s Video) Guide design - http://crispr.mit.edu/ CRISPR Google Group - https://groups.google.com/forum/#!forum/crispr
Editor's Notes
- CRISPR/Cas9 gene editing is based on a microbial restriction system, that has been harnessed for genome targeting using only a short sequence of RNA as a guide. The beauty of the system is that unlike protein binding based technologies such as Zinc Fingers and TALENs which require complex protein engineering, the design rules are very simple, and it is this fact that is allowing CRISPR to take genome engineering from a relatively niche persuit to the mainstream scientific community. The principle of the system is that a short guide RNA, homologous to the target site recruits a nuclease – Cas9 This then cuts the dsDNA, triggering repair by either the low fidelity NHEJ pathway, or by HDR in the presence of an exogenous donor sequence. High Efficiencies for both knockouts and knock-ins have been reported and whilst there are understandable concerns about specificity, new methodologies to address these are now being developed And I’ll touch more on that later
- The system itself is comprised of three key components the Cas9 protein, which cuts/cleaves the DNA and Two RNAs - a crispr RNA contains the sequence homologous to the target site and a trans-activating crisprRNA (or TracrRNA) which recruits the nuclease/crispr complex For genome editing, the crisperRNA and TraceRNA are generally now constructed together into a single guideRNA or sgRNA Genome editing is elicited through hybridization of the sgRNA with its matching genomic sequence, and the recruitment of the Cas9, which cleaves at the target site.
- The design rules for CRISPR are straightforward, as you require only a 23 nucleotide sequence that ends in an NGG motif – known as the protospacer associated motif (or PAM site). Of this 23bases, only the first 20 are included in the guide target sequence which is appended to the tracrRNA “fixed scaffold” and together comprise the gRNA. So as the only requirement is this NGG, on average eligible PAM sites can be found every 12bp, although this will depends on sequence Several tools for gRNA design – HD has our own. One of the key considerations is what is the off target potential of my guide – very often even a 23 base pair sequence will be found elsewhere in the enormity of the genome, and even if an exact match isn’t observed there may be instances of homology with a few mismatches. In fact the specificity of the CRISPR system remains a concern for researchers, especially where minimising off target modifications is critical, such as those working in the field of gene therapy. Various approaches are being taken improve specificity - Interestingly recent work by Keith Joung’s lab has shown using a 17bp target region can reduce some of the off target potential that guides have
- Another approach has been to mutate the nuclease such that it will only nick one strand of the dsDNA, a nickase form of the protein. Nicks will in general be repaired by the base excision repair pathway which is significantly higher fidelity than NHEJ. Targeting strategies using the nickase are designed with two gRNAs, one to recruit the nickase to each strand of the DNA, only after which a DSB will be introduced. This increase in specificity is unfortunately at the expense of some efficiency at you’re at the mercy of your weakest guide in the pair
- So in contrast to the wild type, which will introduce a double strand break 3 bases to the 5 prime of the PAM site, the D10A nickase will cut only the opposite strand at this position. Work is still being done to understand the best strategies for using this system – and a lot of this work is showcased in a recent paper from Keithjoungs lab
- Data suggests that two nicks that result in a 5’ overhang are most efficient at being modified It has also been shown that the distance or “offset” between the two guides is important for efficiency.
- So just to give you an idea of the kind of things that can be achieved with CRISPR genome editing, I want to just run through a couple of examples of the kind of projects we’re running in house at Horizon.
- gRNAs designed to cut within conserved exon 3 to introduce indels and induce frame shift mutations Cells were transfected with the gRNA and Cas9 plasmids and 96 clones screened by PCR to identify those that had modified the three copies of the MAPK3 gene Twenty eight clones showed evidence of cutting at the target locus Seven clones were sequenced and of these three showed out of frame indels on all three alleles The very fact that NHEJ is error prone means modifications that are introduced are random, and this can mean that each allele will have a different modification (making sequencing difficult). We therefore use Top cloning to deconvolute
- DNA from the clones was analysed by PCR and TOPO cloning followed by sequencing of the products 5 base deletion 4 base deletion 2 base deletion and 21 base insertion (combined = 19 base insertion)
- gRNAs designed to cut within the Rosa26 locus in HEK293 cells Plasmid donor used to introduce a promoter driven Cas9n gene at the site of the DSB by homology directed repair
- Example: Insertion of the Cas9n gene into a safe harbour locus for constitutive expression PCR Screening of targeted HEK293 cells revealed approximately 10% of the clones had integrated the Cas9n at the Rosa26 locus Copy number analysis of the integrated gene by digital PCR confirmed only one copy of Cas9 present in the cell line (although the second allele had been cut) The targeted lines were transfected with paired gRNAs against a variety of targets and assessed for Cas9 nickase activity by surveyor assay:
- The design of CRISPR system is simple and Genome editing might appear as simple as: Identifying a gRNA target sequence Ordering an oligo with the target sequence and cloning it into a gRNA vector Transfecting cells with the gRNA + Cas9 + Voila! well… is not always that simple, there are things you need to consider
- And as we are running gene editing projects every day at Horizon we’ve learnt from experience that there are various ways that things can go wrong if you don’t consider the following, and I want to briefly run through each of these one at a time.
- The first group of considerations regard the quirks of your specific target gene How many copies of your gene exist in your cell line? Many of us use transformed human cell lines – there aren’t many that actually come with a normal copy number of 2. For many, many, years people using HeLa cells - quadroploid – see pic = mess -Their karyotype is very different from wild type and they might have multiple copies of an allele It is important to understand YOUR cell line. Do you need to modify all alleles present? Would KO of one allele and modification of the other be viable/acceptable? This is something that happens frequently with CRISPR. When you make the modification do you expect it affect the growth of the cells? When the gene alteration we are trying to make don’t seem to be able to be isolated and then they tell us expts with shRNAs show viability of cells affected by modification
- The second category, and this is probable the one that causes us here at Horizon the most trouble/has required a lot of hard-won expertise - the suitability of the cell line. For example: Need to get DNA into cells..Does your cell transfect/electroporate well? Should you transduce instead? Can the cell line be single cell dilute (SCD)? (Single cell or as in Top panel = triplicate stuck together – takes a long time to separate artefacts) And have it come back at reasonable growth levels? Even if the cell line grows very well, it might not tolerate single cell dilution and you need to find the most suitable conditions to let the cell line grow What is the doubling time? Optimal growth conditions? Looked at whole panel of media formulations, additives, diff seeding densities..(see panel on bottom gives example of taking 1 particularly hard cell line and trying a range of conditions to find the conditions most suitable for SCD
- Now let’s get to the most interesting part the guide RNA design gRNA design: A very important consideration is What source you are using for your genomic sequence? Even a single base discrepancy can be the difference between success and failure with CRISPR and most of these other technologies. It is important that you know what the target looks like IN YOUR cell line. We therefore highly recommend that you sequence all alleles in your cell line so you know what you are targeting. 1bp or 2bp difference will have a big effect on whether you are going to be able to make an effective change. Imperative that you make sure you understand your target region so that your guides are appropriately designed to your real sequence. That’s one of the strengths of the gUIDEbook guide design system that we have developed jointly with Desktop Genetics – see example of output in slide – need to use it to identify potential guides and figure out how close are they to the modification want to make? Distance does matter! How close is the guide to the desired mutation? Distance is important, particularly for something like a point mutation. The closer the cut is to the change you want to make the most effective will be the guide. What are the potential off-target considerations? We pay a lot of attention to this at Horizon, the design algorithm takes into account all the sites that are obviously a perfect match and up to 1, 2, 3, or 4bp mismatched potential off effects elsewhere in the genome. Sometimes, can’t avoid; common to have some mismatches but need to know if in coding or non-coding. If non-coding is it in a regulatory region?
- Once you have guide designs it can pay dividends to validate their activity before hand. The accepted wisdom is to design 5 guides (or 10 if using pairs). Activity can be assessed semi quantitiatively using the Surveyor assay. This done, you can then take just one or two forward for gene targeting in your cell line of choice.
- Donor must be sufficiently different to prevent re-cutting Include silent mutations However, consider effects on expression on splicing Also to consider is nature of donor – selection? Delivery method? If you can imagine, even if you dsb is repaired by the HDR pathway, unless your donor is sufficiently different from you guide target sequence, you’re at high risk of having your modified allele further modified with CRISPR cuts and indels. It is highly recommended therefore to include with your donor silent mutations in the guide target sequence. If you alter the donor, in a coding region like our hypothetical example, how will codon substitutions affect the outcome? Will expression or splicing be affected? How big a donor do you need, how many changes are you introducing – where do you derive donor from? For targeting, every single bp important…also impt. on the donor side of things - want to introduce as few changes as possible in donor in order to achieve highest efficiencies. Can use selection but need to be careful as introducing another ORF. So you can see, there’s a lot to consider and a lot of value in working with a company that can do much more than just providing plasmids Between our personal expertise and through our design tool we have implemented a donor design module that helps us to design the perfect donor for your project, and which will be stable and in-frame.
- What is your like probability of your targeting desired event?
- Guidebook will include a donor design module which will help to improve your cahnces of success by introducing silent mutations, and reducing the risk of recutting
- Armed with all the above information on the nature of the cell line, your transfection efficiency and your guide activity, you next consideration will be how many cells do you need to screen to have a chance of finding a positive. In our case, as we’re looking for a single modified allele which at best will be ¼ of those cells that have been targeted we will need to scale up our screen accordingly. The method you use to screen will depend largely on the modification your introducting – if for example you’re inserting a tag, you can screen using PCR at that locus. If you’re introducing a framshift that will disrupt a restriction site, this can be used. Finally, in many knock-outs the modification on each allele will be different, and so the surveyor assay can be used.
- Finally, once you have identified a clone or clones that you believe contain your desired mutation the ultimate step is the validate these. Of most interest is certainly going to be the nature of the modifications introduced at your target site – whether for example insertion deletions are present on all of your alleles, and if so, whether they result in frameshifts. You may also wish to assess the off-target cutting in your clones, whether mutations have been introduced at your prediced off target sites, and you can do this using sequencing. Finally, there are various other factors that will be critical to the utility of your cell line. Does the modification express (if it’s a knock-in) or not (if it’s a knock-out). Does your cell line remain genomically stable over multiple passages. And finally, given the length of time cells must remain in culture, and also the degree of handling we always test our engineered lines for contamination with mycoplasma and other microbes.
- In summary If we however, try to consider them in the context of a hypothetical experimental goal this might help, and so for the sake of this example lets say we want to introduce a point mutation the coding sequence of a single allele of a gene, and we want to use CRISPR to make this happen Further to this we….
- Recent data from Feng Zhang’s and Eric Lander/David Sabatini’s laboratories indicate lentivirally delivered sgRNA can drive efficient enough cleavage of target genomic sequences that the technology can be used for whole genome screens Results can then be assessed using next generation sequencing, with each sgRNA effectively acting as a bar code This style of screen will complement or replace si or shRNA screens of a similar nature
- SO the principal is that you synthesis a guide or guides against every gene in the genome, with the aim being that that guide is capable of disrupting the coding sequence of the gene and knocking it out. These guides are cloned into a lentiviral delivery system to generate what has become known as a lentiCRISPR library You can use this library to transduce cells, and by using the guides themselves as barcodes ask the question which guides are enriched when treated with a drug for example vs my control cell. This for example would tell you which knock-outs promotes resistance to this drug In the case of the two papers on the previous slide, the proof of concept was to look for those genes that are essential.
- What’s really exciting about this approach is that it dispenses with one of the downsides of RNAi, which is incomplete knockdown, and the potential that this might mask results. This was highlighted in the Shalem paper where they directly compare the knockdown efficiency of siRNAs targeting GFP in a stable cell line vs sgRNA. As you can see whilst only a very small proportion of cells continue to exhbit fluoresence when targeted with sgRNA, the knock-down with shRNA is significantly less efficient..
- One limitation of the origanal lentiCRISPR screening vectors was that due to their size only low titers of virus were achieved. By vector clean up and optimzation a V2 vector has been produced that gives 10 fold improved titre over v1. Further to this, for hard to infect lines a two vector system have been developed, which by splitting the Cas9 and sgRNA across two vectors with different selection markers enables 10 fold improved titre again on the v2 vector.
- As well as the vector, the sgRNA libraries have also been improved – for example, v2 gecko now contains 6 sgRNA per gene as well as miRNA targets and control sgRNA, and is available both in the single and dual system.
- So what are we doing in house? Placing sequences that encode sgRNA vs. non-coding sequences in the RFP variant and sgRNAs vs. putative hit genes in the GFP variant Infecting 12 or 24 well plates with mixtures of the GFP and RFP lentivirus and tracking the abundance of green and red fluorescent cells with time. Cells infected with a lentivirus encoding an sgRNA vs. a gene that modulates survival under the assay conditions will either drop out of, or accumulate in the population, leading to a change in the ratio of green to red fluorescence.
- Historically Horizon’s tool of choice for gene editing was rAAV – for reasons not yet fully understood rAAV is very good at stimulating HDR, and so the system is perfect for introducing very precise modifications into the genome. However, in general these modifications will only be introduced onto a single allele, which means that whilst it’s a great system for knock-in’s it lacks the efficiency of nucleases when it comes to knock-outs. What we’re able to do now however is combined our experience with rAAV with CRISPR – evidence in the literature suggests that DSBs can stimulate HDR by rAAV, and we’ve found that by combining a cut with CRISPR and rAAV delivery of the donor we can improve efficiency of HDR by 50 fold. In this case we have an in hosue testing system, a cell line containing a mutant (non-fluoresecent) GFP, and we can measure efficiency of targeting by rescue of fluoresence in FACS.
- And finally on to our big announcement. We want your cell lines and we’re prepared to offer free guide design and cloning to you to get them. Open to any academic researcher, you can come to Horizon with any human gene and we will provide you with 5 guides cloned into all-in-one plasmids that express Cas9. In return we ask for feedback on which guide or guides worked and a license to your cell line – we pay a royalty in return We will be officially launching this initiative in a couple of weeks, but please let me or one of my colleagues know what gene or genes you would like to knockout to register your interest!
- And now on to Horizon’s GENASSIST line of products and services Horizon has launched a range of gene-editing kits and reagents to enable easier, robust implementation of CRISPR and rAAV gene-editing experiments I will start here on the light blue boxes at the bottom and then I’ll talk about the other parts of our offer in more detail. At Horizon we have been creating functional tools and services to tangibly benefit drug/diagnostic developers in the form of isogenic cell lines that accurately model target patient genetics: X-MAN cell lines To support your work and to give you a solid foundation for further gene editing, we have made our entire portfolio of over 500 X-MAN cell lines available to be modified through GENASSIST We also offer QuickStart CRISPR-Ready cell lines that express stably Cas9 nickase under the control of a CMV or PGK promoter. As these cell lines constitutively express Cas9 nickase (integrated into the genome to ensure stability), only the guide RNA(s) needs to be transfected or transduced into the cell in order to drive CRISPR gene editing. If you would like a CRISPR-Ready cell line in a background different from those we currently have available, we also have Rosa26 donor plasmids designed to incorporate Cas9 nickase into the genome, an RNA guide plasmid to target Rosa26 locus. Our offering is complemented by high-level scientific support for customers that can make the difference between success and failure. This is more than just standard technical support, as it is with the same Horizon scientists who are true experts, performing gene editing every day. Finally, many cell lines can be hard to transfect, and so transduction may be a better option for your project. To support this, we are able to package any plasmid in adenovirus particles for easy transduction.
- Horizon has the strongest IP position on the market We have invested with the intent to ensure that our customers have a risk free environment to benefit from CRISPR gene editing now and in the future.