Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

Μάθημα: Βιολογία. Γ' Γυμνασίου-Σημειώσεις σχολικού βιβλίου

Δημήτρης Καρατζάς,
Βιολόγος-Υποψήφιος Διδάκτορας
--------
Ελληνογαλλικό Κολέγιο "ΔΕΛΑΣΑΛ"
2012

  • Login to see the comments

Μάθημα: Βιολογία. Γ' Γυμνασίου-Σημειώσεις σχολικού βιβλίου

  1. 1. 1.Τα μόρια της ζωής Υπάρχουν 92 χημικά στοιχεία σε ελεύθερη μορφή. Ιχνοστοιχεία: Στοιχεία που βρίσκονται σε μικρή ποσότητα (Κ, Να, Μg). Ο C, το Ο και το Ν συμμετέχουν σε ποσοστό 96% στους οργανισμούς! Στοιχεία που ενώνονται μεταξύ τους, δημιουργούν τις χημικές ενώσεις. Ανόργανες Οργανικές (ενώσεις άνθρακα)Νερό: 70% της επιφάνειας του πλανήτη και 70% Υδατάνθρακες (σάκχαρα):του ανθρώπινου σώματος και του κυττάρου •Απελευθερώνουν ενέργεια •Δομικά συστατικάΜορφές: χιόνι, βροχή, χαλάζι Μονοσακχαρίτες: γλυκόζηΤα φυτά το προσλαμβάνουν με τις ρίζες Πολυσακχαρίτες: άμυλο, κυτταρίνητους και το επαναφέρουν στην Πρωτεΐνες:ατμόσφαιρα με τη διαπνοή. •Δομικά & Λειτουργικά συστατικά Αποτελούνται από αμινοξεά (20)Ρόλος: Διατήρηση ζωής, διαλύτης κ καταλύτηςαντιδράσεων , μεταφορά ουσιών Λιπίδια: •Δομικά συστατικά •Απελευθερώνουν ενέργεια Νουκλεϊκά οξέα (DNA&RNA): •Κληρονομικότητα Αποτελούνται από νουκλεοτίδια Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας
  2. 2. Νερό χωρίς άλατα (βροχή) Νερό με άλατα Εξάτμιση νερού Παραμονή αλάτων στη θάλασσαΘαλασσινό νερό: 4% άλατα Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος 2012 Διδάκτορας
  3. 3. 1.2 Κύτταρο: η μονάδα της ζωής Η λειτουργική μονάδα όλων των οργανισμών είναι το κύτταρο ΤΟ ΕΥΚΑΡΥΩΤΙΚΟ ΚΥΤΤΑΡΟ Περιβάλλεται από την πλασματική μεμβράνη Περιέχει τα εξής κυτταρικά οργανίδια:Πυρήνας: Κενοτόπια:• «Κέντρο ελέγχου» Αποθήκες θρεπτικών ουσιών• Περιέχει το DNA του κυττάρου •Πεπτικά (ζωικό κύτταρο)Ενδοπλασματικό δίκτυο: •Χυμοτόπια (φυτικό κύταρο)Δίκτυο αγωγών για μεταφορά ουσιών μέσα Μιτοχόνδρια:στο κύτταρο Κυτταρική αναπνοήΛείο: Αδρό: Εξασφάλιση ενέργειαςΣύνθεση λιπιδίων Έχει ριβοσώματα για σύνθεση Χλωροπλάστες:Golgi: πρωτεϊνών ΦωτοσύνθεσηΤροποποίηση πρωτεϊνώνΛυσοσώματα:Διάσπαση ουσιών και μικροοργανισμών Κυτταρικό τοίχωμα: Στήριξη φυτικού κυττάρου Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας
  4. 4. Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας
  5. 5. ΤΟ ΠΡΟΚΑΡΥΩΤΙΚΟ ΚΥΤΤΑΡΟ π.χ. βακτήριο•Δεν έχει πυρήνα!•Δεν διαθέτει οργανίδια εκτός απόελεύθερα ριβοσώματα•Είναι μικρότερο σε μέγεθος•Έχει πλασματική μεμβράνη, κυτταρικότοίχωμα και κάψα.•Συχνά φέρει βλεφαρίδες ή μαστίγια•Δημιουργεί ενδοσπόρια Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας
  6. 6. Νευρικός ιστός: νευρώνες και νευρογλοιακά κύτταρα Ρόλος: μεταβίβαση μηνυμάτων Ερειστικός ιστός: •Συνδετικός •Σκελετικός •Χόνδρινος Μυϊκός ιστός •Καρδιακός •Οστίτης •Λείος Καρδιακός ιστόςΣκελετικός ιστός Επιθηλιακός Ιστός: (πχ επιδερμίδα, βλεννογόνοι) Λείος ιστός Ρόλος: προστασία , απορρόφηση ουσιών Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος 2012 Διδάκτορας
  7. 7. ΚΕΦΑΛΑΙΟ 2ο Οι οργανισμοί στο περιβάλλον τουςΠληθυσμός: Οργανισμοί του ίδιου είδους που ζουν στην ίδια Βιότοπος: Το περιβάλλον μιας περιοχής στηνπεριοχή οποία ζουν πληθυσμοί Βιοκοινότητα: Διαφορετικοί πληθυσμοί διαφόρων Μεγάλες ομοιότητες εσωτερικά και ειδών στον ίδιο βιότοποΕίδος εξωτερικά Οικοσύστημα: Οι οργανισμοί ενός Γόνιμοι απόγονοι μετά από διασταύρωση βιοτόπου και οι μεταξύ τους σχέσεις Πληθυσμοί διαφόρων ειδών Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος 2012 Διδάκτορας
  8. 8. Σκοπός όλων των οργανισμών είναι η διαιώνιση του είδους στο οποίο ανήκουν…δηλ. η δημιουργία απογόνων! Προϋποθέσεις: •Επιβίωση (αρμονική συνεργασία ιστών) •Προσαρμογή στο περιβάλλον (τροφή, εχθροί, ζευγάρωμα)Σχέσεις και αλληλεπιδράσεις μεταξύ τωνοργανισμών:•Ερωτικές•Ανταγωνιστικές•Κοινωνικές (ομάδες, ιεραρχία) Ρυθμιστικοί μηχανισμοί για ισορροπία οικοσυστήματος!•Θηρευτής-θήραμα•Συμβίωσης (αμοιβαία προσφορά)•Παρασιτισμού (άνθρωπος-μικρόβιο) Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος 2012 Διδάκτορας
  9. 9. Φωτοσύνθεση ή αυτότροφοι Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας ή ετερότροφοι
  10. 10. Απεικόνιση τροφικών σχέσεων συγκεκριμένων πληθυσμών Τροφικό πλέγμα: Σύνολο τροφικών αλυσίδων όπως βρίσκονται στη φύση (προσοχή στην κατεύθυνση του βέλους!!!) Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας
  11. 11. Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας
  12. 12. Σε κάθε τροφικό επίπεδο περνάει το 10% της ενέργειας και της βιομάζας του αμέσως προηγούμενου 10% 10% 10% Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας
  13. 13. O κύκλος του άνθρακα Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας
  14. 14. ή συμβιωτικά2012 Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος Διδάκτορας
  15. 15. ΠΑΡΕΜΒΑΣΕΙΣ ΤΟΥ ΑΝΘΡΩΠΟΥ ΣΤΟ ΠΕΡΙΒΑΛΛΟΝΡύπανση Κάθε φυσική χημική (ποιοτική ή ποσοτική) μεταβολή του αέρα, του νερού και του εδάφους Προκαλείται από τους ρύπους: ρύπους Αέρια από την καύση ορυκτών καυσίμων Εντομοκτόνα Παρασιτοκτόνα Ακτινοβολίες π.χ. ραδιενέργεια ΡΥΠΑΝΣΗ ΤΟΥ ΑΕΡΑΟφείλετε στα προϊόντα της καύσηςτων ορυκτών καυσίμων από: από Το φωτοχημικό νέφος Βιομηχανίες Το νέφος της Αθήνας Αυτοκίνητα Καφετί χρώμα - μείωση της ορατότητας Συσσώρευση αέριων ρύπων που Οι ρύποι προκαλούν παράγονται από μηχανές καύσης περιβαλλοντικά + O2 + ηλιακή ακτινοβολία προβλήματα Πρωτογενείς ρύποι (ΝΟx, CO, CxHy) 2012 δευτερογενείς Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος ρύποι: PAN, O3 Διδάκτορας
  16. 16. ΕΝΙΣΧΥΣΗ του Φαινομένου του Περιβαλλοντικές ΕΠΙΠΤΩΣΕΙΣ από τηνθερμοκηπίου ενίσχυση του Φαινομένου του θερμοκηπίου H υπέρμετρη καύση ορυκτών καυσίμων: Λιώσιμο των πολικών πάγων Οδήγησε σε αύξηση του στρώματος του διοξειδίου του άνθρακα Ανύψωση της στάθμης της θάλασσας Έτσι αυξάνεται και ακτινοβολία που συγκρατείται από το στρώμα Απώλεια μεγάλων χερσαίων εκτάσεων οι οποίες θα καλυφθούν Αύξηση της θερμοκρασίας της γης με νερό Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος Γενικότερη αλλαγή του κλίματος 2012 Διδάκτορας
  17. 17. Η εξασθένηση της στοιβάδας του όζοντος Ο3 Δράση της υπεριώδους ακτινοβολίας Θανατηφόρο δράση στους Στοιβάδα Ο3 στα ανώτερα στρώματα της μονοκύτταρους οργανισμούς ατμόσφαιρας: Προκαλεί μεταλλάξεις στο DNA Διαδραματίζει σπουδαίο ρόλο στη διατήρηση της ζωής Καταρράκτη Απορροφά μεγάλο μέρος της Καρκίνο του δέρματος υπεριώδους ακτινοβολίας χλωροφθοράνθρακες Δημήτρης Καρατζάς, Βιολόγος- 2012 Υποψήφιος Διδάκτορας
  18. 18. Όξινη βροχή Συνέπειες του φαινομένου Δημιουργία του φαινομένου Καταστρέφεται το φύλλωμα των Απελευθέρωση στην ατμόσφαιρα οξειδίων του δέντρων αζώτου ΝOx και διοξειδίου του θείου SO2 Θανατώνονται οι φυτικοί και ζωικοί από: οργανισμοί των υδάτινων Ηφαιστειακή δραστηριότητα οικοσυστημάτων Αποικοδόμηση από βακτήρια Διάβρωση των μαρμάρινων μνημείων Καύση υγρών καυσίμων Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος 2012 Διδάκτορας
  19. 19. Φαινόμενο του ευτροφισμού Πρόκληση του φαινομένου: Τα αστικά λύματα Τα λιπάσματα Είναι πλούσια σε ουσίες και αυξηση του ζωοπλαγκτου Συσσώρευση νεκρής οργανικής ύλης από την αύξηση των θανάτων μεταξύ τους Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος 2012 Διδάκτορας
  20. 20. Οφείλεται στην δραστηριότητα του Ρύποι του εδάφουςάνθρώπου Ραδιενεργές ουσίες Βιομηχανική δραστηριότητα: Εντομοκτόνα Βαρέα μέταλλα κ.α. Βαρέα μέταλλα όπως Αστικά υδράργυρος, ψευδάργυρος και απορρίμματα μόλυβδος: μόλυβδος Πυρκαγιές Δεν διαλύονται με το νερό Μεσογειακό κλίμα Μπορούν να περάσουν στον Το κλίμα ευνοεί την εκδήλωση φωτιάς άνθρωπο μέσω των τροφικών αλυσίδων Επαναδημιουργία τους σε 10 χρόνια Παρασιτοκτόνα εντομοκτόνα Οι υπόγειοι οφθαλμοί δεν καταστρέφονται αλλά σχηματίζουν Με την απορροή νέους βλαστούς και φύλλα καταλήγουν στη θάλασσα Αυξημένη φύτρωση σπερμάτων που Διαταράσσουν την διασκορπίστηκαν λόγο της φωτιάς ισορροπία των υδάτινων Όταν: οικοσυστημάτων Καεί επανειλημμένα Υπερβοσκηθεί Υπερβοσκηθε Καταστροφή των φυτών Το έδαφος παύει να συγκρατείται από τις ρίζες των φυτών Οι βροχές σχηματίζουν χείμαρρους 2012 Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος Διδάκτορας Ερημοποίηση
  21. 21. ΟΜΟΙΟΣΤΑΣΗ Διατήρηση σταθερού εσωτερικού περιβάλλοντος ανεξάρτητα από τις συνθήκες του εξωτερικού περιβάλλοντος στο οποίο ζει πχ Ομοιοστατικοί μηχανισμοί ρυθμίζουν: ρυθμίζουν Θερμοκρασία του σώματος pH του αίματος Συγκέντρωση της γλυκόζης στο αίμα Συγκέντρωση των αλάτων στο αίμα Ρύθμιση θερμοκρασίας στον άνθρωπο Άνοδος Φυσιολογική Πτώση θερμοκρασίας θερμοκρασία θερμοκρασίας Συστολή αγγείων Διαστολή αγγείων δέρματος δέρματος Ανόρθωση τριχών Ενεργοποίησηιδρωτοποιών αδένων Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 τρέμουλο Διδάκτορας
  22. 22. ΔΙΑΤΑΡΑΧΕΣ ΤΗΣ ΟΜΟΙΟΣΤΑΣΗΣ Παροδικές διαταραχές Μη αντιστρεπτές διαταραχές ΑΣΘΕΝΕΙΑ ΘΑΝΑΤΟ Προκαλούνται απο: Παθογόνος Τρόπο ζωής Ακραίες μεταβολές των περιβαλλοντικών συνθηκώνμόλυνση Παθογόνοι μικροοργανισμοί Ψυχολογικές δυσλειτουργίες Κληρονομικές δυσλειτουργίες Επιδημία Ξενιστής Μεγάλος αριθμός κρουσμάτων μιας ασθένειας σε μιαΧρόνος επώασης συγκεκριμένη Ο χρόνος που μεσολαβή από τη χρονική περίοδο μόλυνση μέχρι την εμφάνιση των Πανδημία Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος 2012 πρώτων συμπτωμάτων της ασθένειας Παγκόσμια εξάπλωση Διδάκτορας
  23. 23. ΙοίΤρόποι μετάδοσης της ασθένειας Παρασιτούν σε κύτταρα του Μέσω του αέρα ξενιστή και πολ/νται Μέσω νερού Πολλοί ιοί παραμένουν σε Μέσω της τροφής λανθάνουσα κατάσταση Μέσω μολυσμένων μέσα στα κύτταρα για πολύ αντικειμένων μεγάλα χρονικά διαστήματα Μέσω των ζώων χωρίς ο οργανισμός να Μέσω του αίματος εκδηλώνει τα συμπτώματα της ασθένειας Μέσω της σεξουαλικής επαφής Κάποια στιγμή μπορεί να ενεργοποιηθεί και να πολλαπλασιαστεί Κατηγορίες μικροοργανισμών (Βακτήρια, ιοί, μύκητες, πρωτόζωα) Μύκητες μυκητιάσεις Μεταδίδονται μέσω ΒΑΚΤΗΡΙΑ της επαφής με μολυσμένα αντικείμεναΧρήσιμα ή αβλαβή παθογόνα Πρωτόζωα Π.χ. το πλασμώδιο που Άμεση Έμμεση με προκαλεί την ελονοσία π.χ. βιτ. Κ προσβολή τοξίνες 2012 ιστού Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος Διδάκτορας
  24. 24. ΑΜΥΝΤΙΚΟΙ ΜΗΧΑΝΙΣΜΟΙ Εξωτερικοί Εσωτερικοί (παρεμοδίζουν είσοδο μικροβίων) (Παρεμποδίζουν εγκατάσταση και πολ/μο μικροβίων) •Δέρμα Γενικοί Ειδικοί •Ιδρωτοποιοί αδένες •Φλεγμονή Λευκοκύτταρα •Σιελογόνοι αδένες στόματος •Πυρετός Αντισώματα •Βλεννογόνοι •Αντιμικροβιακές ουσίες •Εξειδίκευση •Πεπτικός σωλήνας (HCl) •Φαγοκυττάρωση • ΜνήμηΑντιγόνο Κάθε ξένη ουσία που εισέρχεται στον οργανισμό πχ: Ένας ολόκληρος μικροοργανισμός Ουσίες που παράγονται από μικροοργανισμούς π.χ. τοξίνες Ένα τμήμα του μικροοργανισμού Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος 2012 Διδάκτορας
  25. 25. ΕΜΒΟΛΙΟ VS ΟΡΟΣΕΜΒΟΛΙΟ ΟΡΟΣ Τρόπος πρόληψης μιας Τρόπος αντιμετώπισης μιας ασθένειας ασθένειαςΤι περιέχει Τι περιέχει Νεκρούς μικροοργανισμούς Έτοιμα αντισώματα που Ανενεργούς μικροοργανισμούς παράγονται από άλλο άτομο Τμήματα μικροοργανισμών Για ποιο λόγο χορηγείται;Για ποιο λόγο χορηγείται; Για την άμεση εξουδετέρωση Ενεργοποιείται το του αντιγόνου στο χρόνο ανοσοβιολογικό σύστημα επώασης του Παράγονται κύτταρα μνήμης Δεν παράγονται κύτταρα μνήμηςΤι εξασφαλίζεται; Ανοσία Τι εξασφαλίζεται; Σε μελλοντική προσβολή Παροδική ανοσία του από το συγκεκριμένο Σε μελλοντική προσβολή αντιγόνο θα το του από το συγκεκριμένο εξουδετερώσει ταχύτατα μικροοργανισμό θα πρέπει και δεν θα εμφανιστούν τα να του χορηγηθεί εκ νέου 2012 συμπτώματα Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιοςορός Διδάκτορας
  26. 26. ΤΡΟΠΟΣ ΖΩΗΣ & ΑΣΘΕΝΕΙΕΣ Έλλειψη άσκησης Κακή διατροφή Εθισμός Χρήση εξαρτησιογόνων Ψυχική εξάρτηση ουσιών Σωματική εξάρτηση •Νικοτίνη •Αλκοόλ •Ναρκωτικά •Καφεΐνη •Φάρμακα Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας
  27. 27. ΚΕΦΑΛΑΙΟ 5ο Το γενετικό υλικό οργανώνεται σε χρωμοσώματα Ομόλογα Αρσενικό άτομο (22Α+ΧΥ) Θηλυκό άτομο (22Α+ΧΧ)2012 Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος Διδάκτορας
  28. 28. Η ροή της γενετικής πληροφορίαςΔομή νουκλεϊκών οξέωνDNA RNA Ουρακίλη!!! Νουκλεοτίδιο Κυτοσίνη Βάση Γουανίνη Φωσφοδιεστερικοί Δεσμοί υδρογόνου Αδενίνη δεσμοί Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος 2012 Διδάκτορας
  29. 29. ΚΕΝΤΡΙΚΟ ΔΟΓΜΑ ΒΙΟΛΟΓΙΑΣ Αντιγραφή Αντιγραφή DNA •Σπάνε οι δεσμοί κ ανοίγει η διπλή έλικα •Μένουν αζευγάρωτες οι βάσεις •Ένωση αζευγάρωτων με ελεύθερα νουκλεοτίδια (βάσεις) •Σχηματισμός νέας συμπληρωματικής αλυσίδας •Κάθε νέα αλυσίδα θα έχει ένα μητρικό και ένα θυγατρικό κλώνο Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας
  30. 30. Μεταγραφή DNA σε mRNA •Σπάνε οι δεσμοί κ ανοίγει η διπλή έλικα •Μένουν αζευγάρωτες οι βάσεις •Συμμετέχει ΜΟΝΟ Η ΜΙΑ έλικα του DNA •Ένωση αζευγάρωτων με ελεύθερα νουκλεοτίδια (βάσεις) •Σχηματισμός συμπληρωματικής αλυσίδας με ουρακίλη αντί θυμίνης •Απομάκρυνση RNA2012 •Κλείσιμο DNA Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος αλυσιδών Διδάκτορας
  31. 31. Μετάφραση mRNA σε αμινοξέα και δημιουργία πρωτεΐνης 3 είδη RNA mRNA: Μεταφέρει την γενετική πληροφορία από τον πυρήνα στο ριβόσωμα tRNA tRNA: Μεταφέρει τα αμινοξέα στο ριβόσωμα rRNA: Συστατικό του ριβοσώματος Γονίδιο: Κάθε τμήμα του μορίου DNA που έχει τη Αμινοξύ δυνατότητα να μεταγράφεται Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας
  32. 32. αμινόξύ πρωτεΐνη r Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας
  33. 33. Μορφές γενετικού υλικού του ανθρώπινου διπλοειδούς κυττάρου κατά τη διάρκεια ενός κυτταρικού κύκλου Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας
  34. 34. Αλληλόμορφα γονίδια Γονίδια που εμφανίζονται με διαφορετικές μορφές Οι διπλοειδείς οργανισμοί διαθέτουν 2 αλληλόμορφα για κάθε χαρακτηριστικό π.χ. Ίδια αλληλόμορφα Άτομο ομόζυγο για το συγκεκριμένο χαρακτηριστικόΔιαφορετικά αλληλόμορφα Άτομο ετερόζυγο για το συγκεκριμένο χαρακτηριστικό (μωβ, λευκά άνθη) Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος2012 Διδάκτορας
  35. 35. •Το αλληλόμρφο του οποίου η δράση εκδηλώνεται στην •Το αλληλόμρφο του οποίου η δράση δεν εκδηλώνεται στηνετερόζυγη κατάσταση ονομάζεται επικρατές και συμβολίζεται ετερόζυγη κατάσταση ονομάζεται υπολειπόμενο καιμε ένα κεφαλαίο γράμμα συμβολίζεται με ένα μικρό γράμμα Παράδειγμα: Το λακκάκι στο πηγούνι ελέγχεται από δύο αλληλόμορφα γονίδια. Το επικρατές είναι το Τ και δίνει λακκάκι και το υπολειπόμενο το t. 2η περίπτωση Άρα: Τ Τ : Έχει λακκάκι Τ t : Έχει λακκάκι t t : Δεν έχει λακκάκι . Λακκάκι χωρίς 1η Περίπτωση Τ Τ t t 50% με λακκάκι και 50% χωρίς 3η περίπτωση . Λακκάκι χωρίς . . Λακκάκι Λακκάκι 2012 Όλοι οι απόγονοι με λακκάκι Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος 75% με λακκάκι και 25% χωρίς Διδάκτορας
  36. 36. 2012 Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος Διδάκτορας
  37. 37. ΜΕΤΑΛΛΑΞΕΙΣΑλλαγές στο DNA είτε τυχαία είτε υπό την επίδραση περιβαλλοντικών παραγόντων Γονιδιακές Χρωμοσωμικές (σε ένα γονίδιο) (σε αριθμό ή κατασκευή πχ αλφισμός χρωμοσώματος) πχ σύνδρομο Down AGTCAGGGAATCTCATCTCA TCAGTCCCTTAGAGTAGAGT G Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος 2012 Διδάκτορας
  38. 38. EΦΑΡΜΟΓΕΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ Επιλεγμένες διασταυρώσεις Οργανισμοί με επιθυμητές ιδιότητες μπίρα ψωμίΠαρασκευή κρασί με τη χρήση τυρί μικροοργανισμών γιαούρτι Γενετική Μηχανική Π.χ Σακχαρώδης Αντιμετώπιση διαβήτηςΜη παραγωγή ινσουλίνης από το 1) Πάγκρεας από βοοειδή ήπάγκρεας χοίρους • μεγάλο κόστος παραγωγής Μεγάλο ποσοστό γλυκόζης στο • μικρές ποσότητες αίμα • αλλεργίες Προβλήματα στο κυκλοφορικό Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος 2012 Διδάκτορας
  39. 39. 2) Με τη γενετική μηχανική: • Χαμηλό κόστος Σύνολο τεχνικών μεταφοράς γενετικού υλικού από έναν • Μεγάλη ποσότητα οργανισμό σε άλλον • Όχι αλλεργίες Οι οργανισμοί που προκύπτουν με τις τεχνικές και φέρουν κάποια νέα κληρονομήσιμα χαρακτηριστικά ονομάζονται γενετικά τροποποιημένοι 2012 Δημήτρης Καρατζάς, Βιολόγος-ΥποψήφιοςΠοικιλία προϊόντων: τρόφιμα, φάρμακα, ορμόνες, εμβόλια Διδάκτορας
  40. 40. Γονιδιακή θεραπείαΧαρτογράφηση ανθρώπινου γονιδιώματος Συσχέτιση γονιδίων και ασθενειώνΕισαγωγή φυσιολογικού γονιδίου στονασθενή Δημήτρης Καρατζάς, Βιολόγος-Υποψήφιος 2012 Διδάκτορας

×