The Aedes aegypti mosquito is a major vector of blood-borne pathogens, such as the Dengue, Chikungunya, yellow fever, and Zika viruses. This poster discusses the recombinant expression and purification of a late-phase trypsin- like protease, Aedes aegypti serine protease VII (AaSPVII).

1. RESEARCH POSTER PRESENTATION DESIGN © 2012
www.PosterPresentations.com
Between the years of 2010 and 2014, there were
approximately 1 to 2 million incidences of Dengue
fever in the Latin Americas [1]. The transmission
and subsequent outbreak of this disease is
attributable to the Aedes aegypti mosquito—a
major vector of blood-borne pathogens (BBPs)
such as the Dengue virus, along with the
Chikungunya, yellow fever, and Zika viruses [1,
2]. The Ae. aegypti mosquito is an urban vector
that thrives near populations of people. Blood
meals acquired from vertebrate hosts in these
urban areas provide nutrients for female Ae.
aegypti to complete the gonotrophic cycle and
oviposition [3]. This opportune habitation enables
populations of Ae. aegypti to reproduce
uncontrollably and encourages the infection of
nearby vertebrate populations [1, 2]. Accordingly,
controlling the reproduction mechanism of the
vector population could be useful in impeding the
spread of pathogens associated with this vector.
Our approach examines the structures and
biochemical functions of the Ae. aegypti midgut
serine proteases involved in blood meal digestion.
By understanding these mechanisms, we can
potentially develop small-molecule inhibitors and
disrupt vector reproduction.
The Aedes aegypti mosquito is a major vector of blood-borne pathogens, such as the Dengue,
Chikungunya, yellow fever, and Zika viruses. A female mosquito will often take several blood meals
in a single night to complete the gonotrophic cycle, effectively spreading any blood-borne pathogens it
may be infected with. Potentially useful in streamlining vector control strategies, our approach
examines the structures and functions of Ae. aegypti midgut serine proteases involved in blood meal
digestion. This poster discusses the recombinant expression and purification of a late-phase trypsin-
like protease, Aedes aegypti serine protease VII (AaSPVII). Previous studies were unable to purify
AaSPVII with an N-terminal His6-tag because AaSPVII was found to be autocatalytic, often cleaving
the His6-tag upon recombinant bacterial protein expression. In this study, AaSPVII was, instead,
cloned with a C-terminal His6-tag allowing for successful purification of the protein. In addition, we
investigated chemical environments that appear to minimize the auto-degradation of AaSPVII upon
purification. So far, we have been able to solubly express the C-terminally His6-tagged AaSPVII
protease and have been able to partially purify it using a nickel column. BApNA assays of the enzyme
show some enzyme activity. From here, we will further purify AaSPVII, conduct kinetic experiments,
and compare our results with previous findings.
ABSTRACT
INTRODUCTION
Primers were designed with NdeI and XhoI restriction sites so that AaSPVII can be cloned into
pET29b plasmid directly adjacent to the C-terminal His6-tag (Figure 2). A poly(A) tail was included in
each primer to prevent degradation. In the reverse primer, the stop codon was omitted because it is
already present in pET29b downstream of the His6-tag (Figure 3).
RECOMBINANT CLONING
AaSPVII plasmids were transformed into Shuffle® T7 Express Competent E. coli (New England
Biolabs, Cat #C3029H), suitable for T7 promoter-driven plasmids such as pET29b. These E. coli B
cells are engineered to help with protein folding by forming disulfide bonds within the expressed
polypeptide in the cytoplasm. The transformed cells were grown at 30 °C in Terrific Broth
(ThermoFisher Scientific, cat #BP2468-2). During the logarithmic stage of growth (estimated by
OD600 = 0.5–0.8), protein expression was induced with isopropyl-β-D-1-thiogalactopyranoside
(IPTG), an analog of allolactose, utilizing the lac operon present in pET29b to express the inserted
gene. Protein expression was sustained for 44 hours at 12 °C, stopping before AaSPVII begins to auto-
catalyze. Cell paste was flash-frozen with liquid nitrogen and stored at -80 °C.
PROTEIN EXPRESSION
FUTURE WORK
Other purification conditions that could potentially inhibit auto-digestion (i.e. pH, temperature) will be
explored. Ion-affinity chromatography may be used to further purify partially-purified AaSPVII /
pET29b based on its isoelectric point. Upon fully purifyingAaSPVII, crystallization will help us
identify its structure, and substrate binding assays will allow us to further characterize its enzymatic
capability.
ACKNOWLEDGEMENTS
We would like to thank Dr. Jun Isoe and Dr. Roger L. Miesfeld (University of Arizona) for providing
Ae. aegypti cDNA, the AaSPVII group from Chem131B (San José State University) for their initial
work on the removal of the leader sequence, and James Nguyen (San Jose State University) for his
initial work on the recombinant cloning and expression of AaSPVII with an N-terminal His6-tag. This
work is funded by the NIGMS/NIH SC3 underAward Number SC3GM116681.
REFERENCES
1. Fernández-Salas I, et al. Historical Inability to Control Aedes aegypti as a Main Contributorof Fast
Dispersal of Chikungunya Outbreaks in Latin America. Antiviral Research 2015; 124: 30-42.
2. Calvez E, et al. Genetic Diversity and Phylogeny of Aedes aegypti, the Main Arbovirus Vector in
the Pacific. PLoS Neglected Tropical Diseases 2016; 10: e0004374.
3. Isoe J, et al. Molecular Genetic Analysis of Midgut Serine Proteases in Aedes aegypti Mosquitoes.
Insect Biochemistry and Molecular Biology 2009; 39: 903-912.
San José State University, 1 Washington Square, San José, CA 95112
Kamille A. Parungao and Alberto A. Rascón, Jr.
Recombinant Expression and Purification of Aedes aegypti
Midgut Serine Protease VII (AaSPVII)
PROTEIN PURIFICATION
Crude AaSPVII was purified using a HisTrap
FF nickel column (GE Healthcare Life
Sciences, cat #17-5255-01). Dithiothreitol
(DTT), a reducing agent, was added to the
imidazole buffers to partially unfold the
protein by disrupting disulfide bonds.
AaSPVII / pET29b SHuffle® T7 cell paste was
resuspended in cold, buffer containing 10 mM
imidazole + 250 mM NaCl + 20 mM Tris-HCl
pH 7.2 + 10 mM DTT. The resuspension was
sonicated and centrifuged at 8 °C. The
supernatant (crude lysate) was loaded on to the
AKTA FPLC and purified starting with the
low-imidazole buffer (same as resuspension
buffer) and eluting using a linear gradient of
high-imidazole buffer (500 mM imidazole +
250 mM NaCl, 20 mM Tris-HCl pH 7.2 + 10
mM DTT). Purified fractions were collected in
a 1.5 mL 96-well plate. The fractions
containing AaSPVII-Z / pET29b were pooled
and buffer-exchange via dialysis in 50 mM
sodium acetate pH 5.2 + 1 mM DTT at 4C.
From CDC: Surveillance and Control of Aedes
aegypti and Aedes albopictus in the United States
From Shanghai Jiao Tong University School of
Medicine: Pathogen Biology
FIGURE 1: Oocyte maturation in female Aedes aegypti that were fed with various concentrations of blood [3]. Blood
meals are necessary in the completionof the gonotrophic cycle and the development of healthy oocytes.
Sequence (5’ – 3’)
Melting
Temperature
(Tm) [°C]
Forward Primer AAAAACATATGCTATCAACCGGATTCCATCCGC 65.4
Reverse Primer AAAAACTCGAGAACTCCACTGACTTCGGCCACC 65.04
FIGURE 2: Primers used in AaSPVII PCR amplificationintothe pET29b vector. The resultingAaSPVII insert is
760 bp long. Meltingtemperature was obtained using NetPrimer.
FIGURE 3: pET29b plasmidcloning region (Novagen, cat #69872) showing restrictionsites NdeI and XhoI (blue)
and the His6-tag(green) directlyat the C-terminus of the AaSPVII insert.A C-terminal His6-tagcould help with
the partial purificationof AaSPVII, as autocatalysis has been observed inAaSPVII expressed with an N-terminal
His6-tag,losing the tag before purification.
FIGURE 4 (left): SDS-PAGE of AaSPVII /
pET29b total (purple) and soluble (teal)
samples expressed at 12 °C in Luria Broth.
Time in hours.Autocatalysis is observed at T
= 44.
Intact AaSPVII / pET29b: 27.64 kDa
FIGURE 5 (right): SDS-PAGE of AaSPVII / pET29b total (purple)
and soluble (teal) samples expressed at 12 °C in Terrific Broth. Time
in hours.
To further minimize auto-digestion, additional AaSPVII / pET29b SHuffle® T7 cell paste purified with
the same protocol, except that the imidazole buffers contained 5 mM DTT and 25 µL of 3 M sodium
acetate pH 5.2 was added to the wells of the 96-well plate prior to fractionation (see below).
FIGURE 6:
(top) SDS-
PAGE of
AaSPVII /
pET29b Ni2+
purified
fractions.
(bottom) SDS-
PAGE of post-
dialysis
AaSPVII /
pET29b in
increasing
volumes (µL) of
purified protein.
Auto-digestion
occurred, but
there was still a
significant
amount of intact
AaSPVII /
pET29b.
FIGURE 7: (left) SDS-PAGE of AaSPVII / pET29b Ni2+purified fractions collectedin 50 mM sodium acetate pH 5.2.
(right) SDS-PAGE of post-dialysis AaSPVII / pET29b in increasingvolumes (µL) of purified protein. The 20 µL sample
was so concentrated that it could not clearly travel through the NuPAGE Novex 4-12% Bis-Tris ProteinGel
(ThermoFisher Scientific,cat #NP0321BOX). Auto-digestion still occurred.