React Native vs Ionic - The Best Mobile App Framework
Uses of DNA Evidence in Legal Matters
1. Forensic Science: uses of DNA in
legal matters
In this topic we discuss the uses of DNA in
legal matters
DNA is a powerful tool in the fight against
crime. DNA evidence can identify suspects,
convict the guilty, and exonerate the
innocent.
2. DNA basics
Virtually every human cell contains 23 pairs of
chromosomes; half of each pair is maternal, and the
other half paternal.
Each chromosome is a double helix of two strands.
DNA made of 4 bases ACTG (remember
complementarity in base pairing.
In a sense, one need only to consider one of the two
strands, knowing the base sequence in this one
strand makes the base sequence in the other entirely
predictable
This what makes the DNA a genetic material and its
use in molecular forensics
3. Identifying criminal suspects -- older
methods
Over the past 150 years, forensic scientists have
developed several methods to identify persons from
physical evidence left behind at a crime scene or
disaster scene.
Older methods include:
1. hair -- With a microscope, it's possible to get some
indication of age, sex, and race from hair. Comparing
hairs allows police to identify people, with an error
rate of only one in 4500.
2. bone -- Age, sex, race, and sometimes medical
history can be determined from bones
3. fingerprints -- Fingerprint evidence was introduced in
the late 1800s despite much skepticism. It took
decades before fingerprints were routinely used in
police and court matters
4. Identifying criminal suspects -- older
methods
4. blood -- The four blood groups (A, B, O, AB) were
discovered in 1900.
Blood typing, based on these four groups, can be a
powerful tool for resolving legal matters.
But with only four possibilities per person, there are many
cases in which blood typing is not helpful.
More blood groups have been discovered over the past 100
years, but even these cannot provide the same level of
identification as DNA testing
5. footprints -- The US Air Force records the footprints of its
pilots and other aircrew members before they begin their
flying careers. Because it is protected by a boot, the foot is
more likely to be intact after an airplane crash than the
fingers are.
5. Identifying criminal suspects --
newer methods
Current DNA technology allows any individual to be
distinguished from all other individuals, living or dead
(except an identical twin).
DNA can be recovered from blood, semen, saliva,
bone, teeth, or microscopic flecks of skin or other
tissues.
A cigarette butt casually discarded at a crime scene
has enough DNA-containing saliva on it for analysis.
Similarly the postage stamp or the flap of the
envelope you just licked.
A single hair with attached root is also adequate.
6.
7.
8. DNA content of biological samples:
Type of sample Amount of DNA
Blood 30,000 ng/mL
stain 1 cm2 in area 200 ng
stain 1 mm2 in area 2 ng
Semen 250,000 ng/mL
Postcoital vaginal swab 0 - 3,000 ng
Hair
plucked 1 - 750 ng/hair
shed 1 - 12 ng/hair
Saliva 5,000 ng/mL
Urine 1 - 20 ng/mL
9. Uses of DNA forensic science in
criminal matters
To identify potential criminal suspects
In 1987, DNA screening was used in a landmark case
in Leicestershire, England, to clear an innocent 17-
year-old boy of the rape and murder of two girls.
After analyzing the DNA of 5000 men in 3 villages, the
guilty person was found and convicted.
Since then, thousands of criminals have been
convicted on the basis of DNA evidence, mostly in
murder and rape cases
10. DNA technology and rape
In Austin, Texas (2002) DNA technology was able to
solve the rape of a local college student by requesting
a DNA analysis from the phone cord used to strangle
a victim
He realized that in the course of choking a victim,
enough force and friction is applied to the rope or
cord that the perpetrator’s skins cells may rub off his
hands and be left on the ligature.
In spite of the attacker’s attempt to avoid
identification through DNA evidence by wearing both
a condom and rubber gloves, a reliable DNA profile
was developed from the evidence.
11. DNA technology and rape
During the struggle, the attacker was forced
to use one hand to hold the victim down,
leaving only one hand to pull the phone cord
tight.
The attacker had to grab the remaining end
of the cord with his mouth, thereby
depositing his saliva on the cord.
Although the developed profile came from
saliva rather than skin, DNA not only solved
the case in Austin, but also linked the
perpetrator to a similar other sexual assaults
12. Uses of DNA forensic science in
criminal matters
To exonerate persons wrongly accused of crimes
DNA fingerprinting can show that an accused suspect, or
even a convicted suspect, was not the person who left
DNA evidence at the scene of the crime.
In the US, the FBI has found that DNA analysis
exonerates one out of every three suspects.
DNA analysis has also helped to show whether or not
convicted people might have been wrongly accused.
People have been taken off death row in US as a result
of new DNA evidence.
In addition, DNA evidence has not only helped to freed
innocent persons wrongly accused, but has also helped
to identified the real perpetrator
13. Use of DNA forensic science in military matters
One of the important uses of forensic DNA technology
is to identify the victims of crimes, wars, plane crashes,
and other catastrophes.
Bodies that are fragmented or decomposed may be
identified if known tissue samples from the suspected
victim are available, or if DNA samples from close
relatives are available.
DNA can be recovered from the remains of living things
even after thousands of years, if conditions are right.
US has used DNA technology to identify the remains of
nearly 500 servicemen who died during the Vietnam
War, Korean War and from World War II.
14. Use of DNA forensic science in family matters
By comparing DNA samples from offspring to DNA
samples from suspected parents, paternity and
maternity can be established.
This method is used not only to establish the
correct father in paternity cases, but also in cases of
suspected hospital mix-ups of newborn babies.
DNA analysis can also help answer questions about
biological descendants of a particular family.
DNA analysis can definitively disprove descent, as
in the case of a woman claiming to be Anastasia,
the daughter of Russia's last czar, and the cases of
several pretenders to the throne of France, last
occupied by Louis XVI
15. DNA and human migration patterns
Theories say that modern humans evolved in Africa between
100,000 and 200,000 years ago, and originally consisted of a small
group of 10,000 individuals
Proponents of the African origin of modern humans believe that
humans dispersed out of Africa about 100,000 years ago, reaching
Asia about 60,000 years ago and migrating into New Guinea and
Australia during the ice ages 40,000 years ago.
DNA studies of mitochondrial DNA from hair of aboriginal
inhabitants of the Andaman Islands in the Bay of Bengal (near
India) suggest a close relationship between the aborigines there
and the pygmies of Africa.
A rival theory suggests that modern Homo sapiens arose
independently throughout the world from isolated populations of
the early human, Homo erectus.
A comparison of DNA from people of different ethnic backgrounds
will help solve this controversy.
The current best evidence is that we are all "Out of Africa."
16. Other uses of DNA for Forensic Identification
Identify endangered and protected species as an aid
to wildlife officials (could be used for prosecuting
poachers)
Detect bacteria and other organisms that may
pollute air, water, soil, and food
Match organ donors with recipients in transplant
programs
Determine pedigree for seed or livestock breeds
Authenticate consumables such as caviar and wine
17. The science of DNA forensics
The DNA of any two humans
is more than 99% identical.
It is far too expensive to look
at all of the DNA in order to
find the 1% difference.
Scientists have developed more efficient methods
that are based on properties of DNA that frequently
differ from person to person.
None of these methods can distinguish identical
twins. Identical twins have identical DNA
18. The science of DNA forensics
Recall that virtually every human cell contains 23 pairs of
chromosomes; half of each pair is maternal, and the other
half paternal
The working portions of the chromosomes are the genes.
In a gene, the base sequence essentially codes for protein
construction from free amino acids.
For reasons unknown, between the genes are short
sequences of bases that repeat many times in a row
These are generally refereed as Short Tandem Repeats
(STRs)
Probably more than 30% of the human genome consists of
these tandem repeats.
19. Satellite DNA
The tandem repeats seem to act as fillers or spacers between
the coding portions of the chromosome.
One commonly used STR is located on chromosome 11, and is
called TH01. TH01 consists of the repeating sequence –AATG-
on one strand and –TTAC- on the other.
From here we will look only at the AATG strand, knowing that
everything that is to be said will occur similarly for the
corresponding TTAC portion of the second strand of the double
helix.
These repeated areas or STRs are called "satellite DNA”. In
the example below, the AATG sequence repeats 6 times:
5’..AGTATCTAGCGAATGAATGAATGAATGAATGAATGATCGAGC
GATCTCGT--3’
20. Satellite DNA
In the example of satellite DNA, a sequence of four
DNA letters (AATG) was repeated.
The repeating sequence is not always AATG, nor is it
always a sequence of four letters.
When the repeating sequence has 2-5 DNA letters, it
is called a micro-satellite.
When the repeating sequence has 9-80 DNA letters,
it is called a mini-satellite.
Micro-satellites survive even in
degraded DNA.
21. Satellite DNA
The –AATG- sequence usually is repeated anywhere from 5
to 11 times, and the length of the repeat is inherited and
hence differs from person to person .
Thus, at the TH01 locus on the maternal chromosome 11,
AATG may be repeated 6 times, whereas the paternal
chromosome 11 may show the pattern repeated 8 times.
This 6:8 combination is found in just 3.5% of the population.
Generally many people may have six repeats of –AATG- for
this area of satellite DNA, but there are many other areas of
satellite DNA scattered over the chromosomes.
The chance that two people will have the same number of
AATG repeats at all areas of satellite DNA is exceedingly
small
22. Is DNA effective in identifying persons?
DNA identification can be quite effective if used
intelligently.
Portions of the DNA sequence that vary the most among
humans must be used; also portions must be large enough
to overcome the fact that human mating is not absolutely
random.
Consider the following scenario of a crime scene
investigation .
Assume that type O blood is found at the crime scene.
Type O occurs in about 45% of individuals. If investigators
type only for ABO, then finding that the "suspect" in a
crime is type O really doesn't reveal very much.
If, in addition to being type O, the suspect is a blond, and
blond hair is found at the crime scene, then you now have
two bits of evidence to suggest who really did it.
However, there are a lot of Type O blonds out there.
23. Is DNA effective in identifying persons?
If you find that the crime scene has footprints from a
pair of Nike shoes (with a distinctive tread design)
Then in addition to being type O and blond, is also
wearing shoes with the same tread design, then you
are much closer to linking the suspect with the crime
scene.
In this way, by accumulating bits of linking evidence in
a chain, where each bit by itself isn't very strong but
the set of all of them together is very strong, you can
argue that your suspect really is the right person.
24. Is DNA effective in identifying persons?
With DNA, the same kind of thinking is used
You look for matches (based on sequence or on
numbers of small repeating units of DNA sequence)
at a number of different locations on the person's
genome
One or two (even three) aren't enough to be
confident that the suspect is the right one,
Four (sometimes 5-12) are used and a match at all
these is rare enough that you (or a prosecutor or a
jury) can be very confident ("beyond a reasonable
doubt") that the right person is accused.
25. The science of DNA forensics: Use of
microsatellite DNA
To identify individuals, forensic scientists scan
10-13 DNA regions that vary from person to
person and use the data to create a DNA
profile of that individual (called a DNA
fingerprint).
There is an extremely small chance that
another person will have the same DNA
profile for a particular set of regions.
26. How is DNA typing done?
Only one-tenth of a single percent of DNA (about 3
million bases) differs from one person to the next.
Scientists can use these variable regions to generate
a DNA profile of an individual, using samples from
blood, bone, hair, and other body tissues and
products.
In criminal cases, this generally involves obtaining
samples from crime-scene evidence and a suspect,
extracting the DNA, and analyzing it for the
presence of a set of specific DNA regions (markers).
27. How is DNA typing done
To date scientists find the markers in a DNA sample
by designing small pieces of DNA (probes,
microsatellites markers) that will each seek out and
bind to a complementary DNA sequence in the
sample.
A series of probes bound to a DNA sample creates a
distinctive pattern for an individual.
Forensic scientists compare these DNA profiles to
determine whether the suspect's sample matches
the evidence sample.
The “product principle” is usually used in DNA typing
28. How is DNA typing done
A marker by itself usually is not unique to an
individual; if, however, two DNA samples are alike
at 4 or 5 regions, odds are great that the samples
are from the same person.
If the sample profiles don't match, the person did
not contribute the DNA at the crime scene.
If the patterns match, the suspect may have
contributed the evidence sample.
While there is a chance that someone else has the
same DNA profile for a particular probe set, the
odds are exceedingly slim.
.
29. How is DNA typing done
The question is, How small do the odds have to be
when conviction of the guilty or acquittal of the
innocent lies in the balance?
Many judges consider this a matter for a jury to take
into consideration along with other evidence in the
case.
Experts point out that using DNA forensic technology
is far superior to eyewitness accounts, where the
odds for correct identification are about 50:50
30. How is DNA typing done
The more probes (markers) used in DNA analysis, the
greater the odds for a unique pattern and against a
coincidental match.
However, each additional probe adds greatly to the time
and expense of testing.
Four to 12 probes are recommended.
Future DNA forensics is likely to use DNA chip technology
(in which thousands of short DNA sequences are
embedded in a tiny chip).
This will enable much more rapid, inexpensive analysis
using many more probes, and raising the odds against
coincidental matches.
31. How is DNA typing done
These "labs on a chip" will require only one millionth
the quantity of DNA that is needed with current
technology.
The entire analysis will likely happen in a portable
unit about the size of a briefcase, which contains
everything needed to cut, amplify, tag, and analyze
the DNA.
This technology is expected to be available in few
years to come
This will allow crime scene investigators to process a
DNA sample at the crime scene and get results
within 10 minutes.
32. How does it work: SRT analysis
Need Crime Scene Samples & Reference
Samples DNA Extract and Purify
PCR reactions are performed in
Eppendorf tubes. Typical volumes are
measured in microliters (one millionth
of a liter).
Groups of amplified STR products are
labeled with different colored dyes
(blue, green, yellow)
37. Statistical estimates: the product rule
1 in 10 x 1 in 111 x 1 in 20
= 0.1
1 in 22,200
1 in 100 x 1 in 14 x 1 in 81
1 in 113,400
1 in 116 x 1 in 17 x 1 in 16
1 in 31,552
1 in 79,531,528,960,000,000
1 in 80 quadrillion
38. Ivory DNA fingerprinting
We trace stolen
ivory to a
particular
population of
elephants by
applying DNA
fingerprinting, a
technique that
analyzes
sequences of
DNA known as
microsatellites
41. Illegal Ivory from TZ???
Monday, July 3, 2006, Kaohsiung Harbor, Taiwan—Routine
automated scan of shipping manifests alerted the Taiwanese
customs officials to two suspicious containers.
Both had departed Tanzania and are at the port en route to the
Philippines, having passed through Kaohsiung once before
during the same voyage.
The containers seemed to be shuttling back and forth between
ports in the Far East with no apparent final destination.
Officials check the hard-copy shipping documents, which
reported that the containers held sisal fiber.
“Exporting sisal fiber from Africa to the Philippines is like
sending snowballs from Sweden to Siberia as the Philippines
grows tons of the fibrous plant.
42. Illegal Ivory from TZ???
The inspectors decided to crack open one of the
containers.
Hidden behind 60 bales of sisal, they uncovered 744
elephant tusks.
The second container held another 350 tusks.
This was equivalent to 5.2 metric tons of illegal African
ivory, with an estimated wholesale value of $4.6 million
and a retail “street value” upward of $21 million.
43. Illegal Ivory from TZ???
Saturday, July 8, 2006, Sai Ying Pun, Hong Kong Island—
Five days after the Taiwanese seizure, a local resident
reports a terrible burning stench coming from a
neighbor’s apartment.
Police and fire units respond quickly. No one replies to
their knocks on the door, so the units force their way in.
They discover seven people cutting and packing what
turns out to be 2.6 metric tons of elephant ivory.
Hong Kong authorities seize 390 tusks plus another 121
cut pieces. Some clues indicate an East African origin.
44. In late June 2002, Zambia Wildlife Authority
officers, Lusaka Agreement Task Force and the
Anti-corruption Bureau of Malawi uncovered
vital information on shipment of a 20-foot • This container had 7
container packed with illegal elephant ivory in crates packed with
Malawi and destined for the Far East. contraband African
elephant ivory weighing
about 6.5 tones
• Had 532 whole tusks and
about 41,000 rough-carved
12-18 mm cylinders similar
to those used for hanko
Teaching opportunity signatures in the Far East
47. • Circles show the
estimated location
of origin of each
sample, while
crosses indicate
locations of
reference samples
from savanna
habitats used to
make the
assignments.
Data point to a
relatively narrow
band of Southern • The actual locations
Africa, centered on of the samples of
Zambia, as the likely known origin are
source of tusks in
highlighted in
this seizure
green.
48.
49.
50. DNA profile for 7 genetic loci were developed from
the dress stain containing high molecular weight
DNA extracted from specimen 03341. Based on
the results of these seven genetic loci, and
specimen KLS. (CLINTON) is the source of the
DNA obtained from specimen 03341-1, to a
reasonable degree of scientific certainty.
56. Other DNA technologies used in forensic
investigations
The DNA revolution began when scientists at Johns
Hopkins discovered enzymes that cut DNA
(restriction enzymes).
This family of enzymes is important because each
member of the enzyme family cuts DNA at a specific
site.
For example, the EcoR1 enzyme cuts DNA whenever
it sees the letters GAATTC:
DNA before EcoR1 cuts:
AATCTAGGGAATTCACAGCGATGCGAATTCGCAATTA
DNA after EcoR1 cuts:
AATCTAGGG AATTCACAGCGATGCG AATTCGCAATTA
57. Some of the DNA technologies used in forensic
investigations
Restriction Fragment Length Polymorphism (RFLP)
RFLP is a technique for analyzing the variable lengths of
DNA fragments that result from digesting a DNA sample
with a special kind of enzyme.
This enzyme, a restriction endonuclease, cuts DNA at a
specific sequence pattern know as a restriction
endonuclease recognition site.
The presence or absence of certain recognition sites in
a DNA sample generates variable lengths of DNA
fragments, which are separated using gel
electrophoresis.
Generally, no two people have their DNA cut into
pieces of exactly the same length because there are so
many slight variations in each person's genes
58. DNA Restriction Enzymes
•Evolved by bacteria
to protect against
viral DNA infection
•Endonucleases =
cleave within DNA
strands
•Over 3,000 known
enzymes
59. Enzyme Site Recognition
Restriction site
Palindrone
•Each enzyme
digests (cuts) DNA
at a specific
sequence =
restriction site
•Enzymes recognize
4- or 6- base pair,
palindromic
sequences
(eg GAATTC)
Fragment 1 Fragment 2
60. 5 vs 3 Prime Overhang
Enzyme cuts
•Generates
5 prime
overhang
62. Restriction Fragment Length
Polymorphism (RFLP)
RFLP is one of the original
applications of DNA analysis to
forensic investigation.
With the development of newer,
more efficient DNA-analysis
techniques, RFLP is not used as
much as it once was because it
requires relatively large amounts of
DNA.
In addition, samples degraded by
environmental factors, such as dirt
or mold, do not work well with
RFLP.
63. Early 1980s: Restriction Fragment Length
Polymorphism (RFLP)
Genetic variation in the distance
between restriction enzyme sites
Template DNA digested by
enzymes, electrophoresed,
Sir Alec Jeffreys detected via Southern blotting
Power of discrimination in the
range of 106-108 for a six probe
analysis
65. RFLPs
Scientists also uses a simple method, called
Southern blotting, that shows the sizes of a
person's DNA pieces.
The example shows the Southern blots for
three different people.
Person #1 has had their DNA cut into two
large pieces that show up on the blot.The
larger piece is toward the top of the
diagram.
The DNA of persons #2 and #3 have been
cut differently, because their DNA is not the
same as that of person #1.
After cutting, persons #2 and #3 have only a
single piece of their DNA show up on the
blot.
Person #2 has the same large piece as
person #1, but lacks the smaller piece.
Person #3 has the smaller piece only.
66. Mid-1980s: The Colin Pitchfork
Case
Two young women raped and
murdered in Narborough, England
5,000 local men are asked to provide
blood/saliva samples
1st exoneration and conviction on
forensic DNA evidence
67. The Catch:
RFLP testing requires a relatively large
amount of HMW DNA (~50ng = thousands
of cells)
Not ideal for forensic evidence, in which
small, degraded samples are common
68. Some of the DNA technologies
used in forensic investigations
Polymerase Chain Reaction =
molecular Xeroxing
Three temperature phases,
Dr. Kary Mullis
carried out in a Thermal Cycler,
Eccentric Genius replicate or “amplify” the
desired DNA fragment(s)
69. Some of the DNA technologies used in forensic
investigations
PCR Analysis
DNA amplification with PCR
allows DNA analysis on
biological samples as small as a
few skin cells.
The ability of PCR to amplify
such tiny quantities of DNA
enables even highly degraded
samples to be analyzed.
Great care, however, must be
taken to prevent contamination
PCR is used to make millions with other biological materials
of exact copies of DNA from during the identifying,
a biological sample collecting, and preserving of a
sample.
Combined PCR-RFLP is widely
used in forensic investigations.
70. PCR (cont’d)
First forensic application is the DQα locus,
later multi-plexed with Polymarker™ loci
using dot-blot detection method
Works with lower quantity (1-2ng), lower
quality samples
Power of discrimination goes from 102-
106...not good enough for databasing
71. Some of the DNA technologies used in
forensic investigations
The Federal Bureau of
Investigation (FBI) in US uses a
standard set of 13 specific STR
regions for Combined DNA Index
System (CoDIS)
CoDIS is a software program that
operates local, state, and
national databases of DNA
profiles from convicted
offenders, unsolved crime scene
evidence, and missing persons.
The odds that two individuals
will have the same 13-loci DNA
profile is about one in one
billion.
72.
73. The Combined DNA Index System
(CoDIS)
A database of DNA profiles from violent
felons and crime scene samples
Laws concerning who is eligible for the
database vary from state to state
Database currently contains about 2,038,470
felons and 93,956 crime scene profiles (19,00
hits so far)
74. The Mystical Power of CoDIS
Extremely powerful
investigative tool, linking
crimes, and pulling suspects out
of thin air!
Can prevent, as well as solve
crimes!
75. The Dark Side of CoDIS
1. DNA mixtures and degraded DNA profiles have lead to spurious matches
For example, an unknown mixture taken from a vaginal swab taken from the
victim of a sexual assault profile with three alleles at the D21S11 locus, ex.
(28, 30, 31) would “hit” on (28, 28), (28, 30), (28, 31), (30, 30), (30, 31), and
(31, 31). A total of 6 genotypes
If we designate an obligate or required allele (+), (28, 30+, 31)* would now hit
only on the following genotypes: (28, 30), (30, 30), and (30, 31). We have
reduced the number of hits at the D21S11 locus by half.
Assigning obligate alleles at as many loci as possible can reduce the number
of spurious hits to the offender database.
* In this example, the victim was determined to be a (28, 31) at D21S11.
Therefore, the 30 allele is foreign to the victim and presumed to be from the
suspect
2. Stringent laws explicitly permit databasing innocent people
3. Adding arrestees to database violates presumption of innocence
78. Mitochondrial DNA Analysis
Mitochondrial DNA analysis (mtDNA) can be used to
examine the DNA from samples that cannot be analyzed
by RFLP or STR.
Nuclear DNA must be extracted from samples for use in
RFLP, PCR, and STR; however, mtDNA analysis uses DNA
extracted from another cellular organelle called a
mitochondrion.
The older biological samples that lack nucleated cellular
material, such as hair, bones, and teeth, cannot be
analyzed with STR and RFLP, can be analyzed with
mtDNA.
In the investigation of cases that have gone unsolved for
many years, mtDNA is extremely valuable.
79. Mitochondrial DNA (mtDNA)
Pros
Single-cell sensitivity because each cell
contains ~1000 mitochondria
Especially useful for shed hairs, burnt remains
Can be used to establish kinship directly
because entire complement of mtDNA is
maternally inherited
80. Mitochondrial DNA (mtDNA)
Cons
Single-cell sensitivity because each cell
contains ~1000 mitochondria = very high
contamination risk!
Heteroplasmy - more than one mtDNA type
manifesting in different tissues in the same
individual
Lower power of discrimination - maternal
relatives all share the same mtDNA
82. MtDNA uses
Since mtDNA has strictly maternal inheritance,
this means mtDNA haplotypes should be shared
by all individuals within a maternal family line.
Mitochondrial DNA is thus useful for studying
the evolution of closely related species
Many studies are focused on the mitochondrial
D-loop region which is the most variable part of
mtDNA
It has a higher substitution rate than in the rest of
the mtDNA genome
83. Uses of mtDNA analysis
Since all mothers have the same
mitochondrial DNA as their
daughters.
Comparing the mtDNA profile of
unidentified remains with the profile
of a potential maternal relative can
be an important technique in missing
person investigations
84. Y-Chromosome Analysis
The Y chromosome is passed directly from
father to son
The analysis of genetic markers on the Y
chromosome is especially useful for tracing
relationships among males
or for analyzing biological evidence involving
multiple male contributors
85. Y-STRs
Problem:
~99% of violent crimes are committed by men
DNA mixtures of male suspect and female victim
can pose an analytical challenge, especially when
the female DNA contribution is much greater than
the male = preferential amplification
Solution:
Test for markers found only on the Y-chromosome.
Only male DNA is amplified!
86. Y-STRs prons
and cons
1. Lower power of
discrimination -
paternal
relatives all
share the same
Y-STR haplotype
2. 10% of Central
Asian males
share the same
Y-STR haplotype
87. Single Nucleotide Polymorphisms
(SNPs)
Point mutations (base
substitutions) found in 1% or
more of the population
1.8 million identified in
human genome
Detected on micro-array
plates with fluorescent tags
(all or nothing response)
88. SNPs (cont’d)
~50 SNPs provides same power of discrimination as 13 STR loci
Certain SNPs are used as predictors of ancestry/ethnicity
Characterizing the admixed African ancestry of African
Americans, by Fouad Zakharia, Analabha Basu, Devin Absher,
Themistocles L Assimes, Alan S Go, Mark A Hlatky, Carlos
Iribarrenl, Joshua W Knowles, Jun Li, Balasubramanian
Narasimhan, Steven Sidney, Audrey Southwick, Richard M
Myersl, Thomas Quertermous, Neil Risch and Hua Tang
Genome Biology 2009, 10:R141 doi:10.1186/gb-2009-10-12-
r141
89. Fingerprints Vs DNA analysis
DNA is often compared with
fingerprints in the way matches
are determined.
When using either DNA or
fingerprints to identify a suspect,
the evidence collected from the
crime scene is compared with a
"known” standard.
If identifying features are the
same, the DNA or fingerprint can
be determined to be a match.
However, if identifying features of
the DNA profile or fingerprint are
different from the known
standard, it can be determined
that it did not come from that
known individual.
90. Fingerprinting analysis
Fingerprinting analysis has been used for more than
a century and is still widely used in law enforcement
agencies.
Because of its unique characteristic, it is conclusive
evidence and a valuable tool among advanced
technology even today.
However, there is a chance it might lose its ground
by DNA fingerprint which is more sophisticated and
accurate than traditional fingerprint.
91. Fingerprints: Friction Ridge skin
Every person has minute raised ridges of skin on the inside
surfaces of their hands, and fingers and on the bottom surfaces
of their feet and toes - known as 'friction ridge skin'.
They are also known as "epidermal ridges" which are caused by
the underlying interface between the dermal papillae of the
dermis and the interpapillary (rete) pegs of the epidermis.
These epidermal ridges serve to amplify vibrations triggered
when fingertips brush across an uneven surface, transmitting
the signals to sensory nerves involved in fine texture
perception
The friction ridges provide a gripping surface - in much the
same way that the tread pattern of a car tire does.
Friction ridge skin is also the only skin on the body without
hairs.
92. Fingerprinting analysis
There are three types of fingerprints that exist at
crime scenes:
Visible prints- made from finger stained with colored
materials such as ink, blood, and grease.
Plastic prints - formed by pressing onto a soft surface
such as clay, soap, and wax and they are visible with
naked eye and do not need no enhancement
Latent print - invisible print left on an object by the
body’s natural greases and oils.
Because it cannot be seen by naked eyes, fingerprint
powders, chemicals, and even lasers are used to make
it visible on the crime scene evidence.
93. Latent Fingerprints
Friction ridges have very small pores along their length that
continuously exude perspiration. The perspiration forms a layer
along the top of the ridges.
When a person touches an object, a moist impression of the
friction ridge pattern is left on that object.
The phrase 'latent fingerprint' is generally used to refer to a
fingerprint, or partial fingerprint, which has been left at the scene
of a crime.
The degree to which a latent fingerprint is visible depends on the
nature of the object touched and the conditions at the time the
object was touched.
Impressions made on smooth non-porous surfaces such as metal,
glass or plastics are sometimes visible to the naked eye.
Such prints can be developed with color contrasting powder that
adheres to the moisture in the fingerprint.
94. Latent Fingerprints
The developed fingerprints are recorded by
photography, and sometimes also by 'lifting' the
impression with adhesive tape.
Impressions made on porous objects such as paper,
cardboard and unfinished timber are generally
invisible.
These prints can be detected and developed with
special lighting, lasers, x-rays and a range of chemical
processes.
Once developed, the fingerprint is generally
recorded by photography.
95. Fingerprinting analysis
The fingerprints can be categorized into three basic formations,
which are loops, arches, and whorl.
Loops are lines that enter and exit on the same side of the print.
Arches are lines that start on one side of the print, rise into hills
and then exit on the other side of the print.
Whorl is circles that do not exit on either side of the print.
Looped prints and the most common account for around 60% of
the world’s population
96. Friction ridges do not run evenly
ridge ending - a ridge that ends
and unbroken across our fingers, abruptly
hands, toes and feet. spur - a bifurcation with a short ridge
They display a number of branching off a longer ridge
characteristics known as bifurcation - a single ridge that
minutiae. divides into two ridges
The principle categories of
dot - an independent ridge with
minutiae are as follows:
approximately equal length and
width
lake or enclosure - a single ridge that
bifurcates and reunites shortly
afterwards to continue as a single
ridge
short ridge, island or independent
ridge - a ridge that commences,
travels a short distance and then ends
crossover or bridge - a short ridge
that runs between two parallel
ridges.
97. Why use fingerprinting in criminal
investigations?
According to most professional criminal investigators,
fingerprints obey three fundamental principles. These
principles are:
1. A fingerprint is an individual characteristic. It is yet to
be found that prints taken from different individuals
possess identical ridge characteristics.
2. A fingerprint will remain unchanged during an
individual’s lifetime.
3. Fingerprints have general characteristic ridge patterns
that permit them to be systematically classified
98. The Principles of Fingerprint Identification
There are two fundamental principles underlying the use of
fingerprints as a means of identifying individuals –
1. Immutability: Friction ridge patterns do not change naturally
during the life of a person.
The pattern of minutiae starts developing in the third month
of pregnancy and is fully formed by the fourth month.
During a person's lifetime, the pattern remains the same,
apart from changing in size or by accident, mutilation or skin
disease, until death.
In fact, the friction ridge patterns will remain after death
until the body decomposes.
99. The Principles of Fingerprint Identification
2. Uniqueness. Friction ridge detail forms in a purely random
manner during fetal development in the womb.
There is sufficient variability in the arrangement of minutiae to
ensure that no two friction ridge patterns are identical,
whether they are on different fingers of the same person or on
the fingers of different people.
While this principle is difficult to prove empirically, no two
fingerprints have ever been found to be identical in over a
century of the use of fingerprinting >hundreds of millions
fingerprinted worldwide.
Additionally, studies have demonstrated that while identical
twins share the same DNA profile markers, they can
nevertheless be differentiated by their fingerprints
100. Methods of fingerprint detection
Crime scene fingerprints may be detected by simple
powders or chemicals applied at the crime scene or by
using chemical techniques applied in specialist laboratories
to appropriate articles removed from the crime scene.
These labs are very advanced and sophisticated detecting
now 50% or more of the total crime scene fingerprints in
the world
To date about 20 effective methods are currently in use in
the more advanced fingerprint laboratories around the
world.
Some of the techniques such as the use of Ninhydrin,
Diazafluorenone, and Vacuum Metal Deposition show quite
surprising sensitivity and are used operationally to great
effect.
101. Methods of fingerprint detection
Ninhydrin or Diaza-fluorenone react with amino
acids. Others such as ethyl cyanoacrylate
polymerisation, work by water-based catalysis and
polymer growth. These methods are very specific
Vacuum metal deposition use gold and zinc and are
non-specific but detect fat layers as thin as one
molecule.
Wide range of fluorescence techniques have also
been introduced, primarily for the enhancement of
chemically developed fingerprints and also for
detection of inherent fluorescence of the latent
fingerprints
102. Livescan devices
There are different types of fingerprint readers
on the market, which all measure in some way
the physical difference between ridges and
valleys.
There are two major families of these devices:
solid-state fingerprint readers and optical
fingerprint readers.
3D fingerprint scanners have now been
developed which employ the detailed 3D
information to rovide very high resolution
103. Fingerprints reveal drug use
The secretions, skin oils and dead cells in the fingerprint contain
residues of various chemicals and their metabolites present in the
body which can be detected and used for forensic purposes.
E.g. fingerprints of tobacco smokers contain traces of cotinine, a
nicotine metabolite; they also contain traces of nicotine itself
NB: This is sometimes ambiguous as its presence may be caused by
mere contact of the finger with a tobacco product.
By treating the fingerprint with gold nanoparticles with attached
cotinine antibodies, and then subsequently with fluorescent agent
attached to cotinine antibody antibodies, a fingerprint of a smoker
becomes fluorescent; non-smokers' fingerprints stay dark.
The same approach is being investigated to be used for identifying
heavy coffee drinkers, cannabis smokers, and users of various other
drugs.
In 2008 English researchers developed methods of identifying users
of marijuana, cocaine and methadone from their fingerprints
104. Word of wisdom
Alexander Hamilton
Men give me some credit for genius, but all of the
genius I have lies in this.
“I explore it in all its bearings”. When I have a
subject in mind, I study it profoundly, day and night
it is before me.
My mind becomes pervaded with it.
The result is what some people call the fruits of
genius, whereas it is in reality the fruits of study and
labor
(as quoted in Sterling W. Sill, The Upward Reach, p.
125).
105. Validity of fingerprinting for identification
The validity of forensic fingerprint evidence is still being
challenged by academics, judges and the media.
While fingerprint identification was an improvement over
earlier anthropometric systems, the subjective nature of
matching, despite a very low error rate, has made this
forensic practice controversial.
Their assessment is still unreliable (successive tests should
bring the same results) and their validity (results should
accurately reflect the external criteria being measured) is
questionable
These specific criticisms are now being accepted by some
leaders of the forensic fingerprint community, providing an
incentive to improve training and procedures.
106. The Importance of Hard Work
Thomas Alva Edison (1847-1931):
“There is no substitute for hard work.”
I am grateful to my parents for teaching me
the value of hard work and the importance of
self-education
107. Dans les champs de l'observation le
hasard ne favorise que les esprits
préparés (Inaugural lecture,
University of Lille, December 7, 1854
In the fields of observation Louis Pasteur
“chance favors (1822-1895
only the prepared mind”
