SlideShare a Scribd company logo
1 of 18
Download to read offline
Role of Service Delivery Platforms in RRRooollleee ooofff SSSeeerrrvvviiiccceee DDDeeellliiivvveeerrryyy PPPlllaaatttfffooorrrmmmsss iiinnn FFFFiiiinnnnaaaannnncccciiiiaaaallll IIIInnnndddduuuussssttttrrrryyyy 
Rehman Adil 
Senior Solutions Architect 
Deutsche Telekom, UK 
10th Annual Service Delivery Innovation Summit 
16th-17th September 2014 
Thistle Marble Arch, London
What I am going to talk about 
How we define Service Delivery Platforms in Telco 2.0 Context 
Becoming Part of the Financial Industry Eco-system – Case Study 
Key Learning from Case Study 
Summary – Take aways 
1
How we define Service Delivery 
Platforms in Telco 2.0 Context
Telco 2.0 - Two Sided Business Model 
3
What does Telco have ? 
24.09.2014 4
Service Delivery Platform - Assets 
Operator 
Billing 
Video 
Content 
Delivery 
Mobile 
Advertising 
Government 
Services 
Enterprise 
Solutions 
Cross 
Operator 
Initiatives 
Vertical 
Industry 
Solutions 
5 
Communications 
Messaging Multimedia 
Voice Conference 
Context 
Identity Location 
Presence Profile 
Access 
QoS Policy 
Bearer Security 
Commerce 
Payments Rating 
Subscriptions Settlement 
Over-The-Top 
Social Login Aggregators 
Partners Hubs 
Solution Enablement Layer
Digital Services Reference Architecture 
SSSSSSSSeeeeeeeerrrrrrrrvvvvvvvviiiiiiiicccccccceeeeeeee LLLLLLLLaaaaaaaayyyyyyyyeeeeeeeerrrrrrrr 
EEEExxxxppppoooossssuuuurrrreeee 
LLLLaaaayyyyeeeerrrr 
LLLLaaaayyyyeeeerrrr 
Third Party 
On-Boarding 
Micro 
Location API 
WebRTC 
/Joyn Network API 
Delegated 
Operator 
Authentication 
Payments 
API 
Subscriptions 
API 
Customer 
Profile API 
Social Login 
Page/ OpenID 
Operator 
Identification 
API 
QoS API 
Short 
Messaging API 
Customer 
Identity API 
Cell-ID 
Location API 
Roaming API 
Voice call API Mobile ID API 
Natural Language 
Understanding API 
LTE Location 
API 
SSeerrvviiccee LLaayyeerr FFuunnccttiioonnaall DDoommaaiinnss SSeerrvviiccee LLaayyeerr CChhaarraacctteerriissttiiccss 
CCuussttoommeerr PPrrooffiillee IIddeennttiittyy 
OOppeerraattoorr DDiissccoovveerryy QQooSS 
SSuubbssccrriippttiioonnss 
PPaayymmeennttss 
SSeerrvviiccee OOrrcchheessttrraattiioonn 
RRuullee--BBaasseedd RRoouuttiinngg 
Fault and Performance 
Monitoring 
TTrraaffffiicc DDiissttrriibbuuttiioonn 
TThhiirrdd PPaarrttyy AAAAAA 
OOppeerraattiioonnaall LLooggggiinngg 
Consent API 
FFiinnaanncciiaall SSeettttlleemmeenntt 
SSeerrvviiccee MMaannaaggeemmeenntt 
AAnnaallyyttiiccss // BBiigg DDaattaa 
6 
PPoolliiccyy EEnnffoorrcceemmeenntt TThhrroottttlliinngg DDaattaa PPrrootteeccttiioonn 
IInntteerrnnaattiioonnaall IInntteeggrraattiioonn LLaayyeerr 
SSeerrvviiccee EEnnaabblleerrss// DDiiggiittaall AAsssseettss//OOTTTT 
NNAATTCCOO IITT EEnnaabblleerrss 
CChhaarrggiinngg 
RRaattiinngg 
SSuubbssccrriippttiioonnss 
AAlllloowwaanncceess//VVoouucchheerrss 
FFuullllffiillllmmeenntt 
CCuussttoommeerr PPrrooffiillee 
CCuussttoommeerr LLiiffeeccyyccllee 
PPrroodduucctt OOffffeerrss//CCaattaalloogguuee 
NNAATTCCOO NNTT EEnnaabblleerrss OOTTTT EEnnaabblleerrss 
CCuussttoommeerr LLooccaattiioonn 
IIMMSS  JJooyynn 
DDTT OOTTTT IIDD PPrroovviiddeerr 
GGlloobbaall MMSSIISSDDNN DDaattaabbaassee 
PPoolliiccyy FFuunnccttiioonn 
MMeessssaaggiinngg 
OOTTTT MMeessssaaggiinngg 
OOTTTT CCoommmmuunniiccaattiioonn CClloouudd 
OOTTTT aanndd NNoonn--OOppeerraattoorr BBiilllliinngg 
CCuussttoommeerr NNeettwwoorrkk IIddeennttiittyy OOTTTT SSuubbssccrriippttiioonnss OOTTTT LLooccaattiioonn 
BBuussiinneessss LLooggggiinngg 
MMeessssaaggiinngg 
CCoommmmuunniiccaattiioonn 
Delegated 
Authentication 
LLooccaattiioonn 
CCoonnsseenntt PPrroottooccooll AAbbssttrraaccttiioonn 
NNoottiiffiiccaattiioonnss QQuueeuuiinngg aanndd SSttaaggiinngg
Becoming Part of Financial Industry 
Eco-System – Case Study
FRAUD PREVENTION SOLUTION FOR CROSS BORDER 
TRANSACTIONS 
Your Location 
Your Credit Card 
8 
With your GSM/LTE phone and network location API our banking partners can readily 
check the country location to prevent fraud at a speed needed for financial transactions!
Fraud Prevention Service 
▪ Two major use cases for cross-border payment card transactions are as follows: 
– RRRReeeedddduuuucccciiiinnnngggg CCCCrrrroooossssssss-BBBBoooorrrrddddeeeerrrr PPPPaaaayyyymmmmeeeennnntttt CCCCaaaarrrrdddd FFFFrrrraaaauuuudddd 
A significant amount of payment card fraud occurs with transactions originating in countries other than the 
cardholder’s own. Providing the Customer with the country that the user’s mobile phone is currently located in will 
allow them to more accurately determine whether transactions occurring in a foreign country are likely to be 
fraudulent. 
– RRRReeeedddduuuucccciiiinnnngggg FFFFaaaallllsssseeee-PPPPoooossssiiiittttiiiivvvveeee PPPPaaaayyyymmmmeeeennnntttt CCCCaaaarrrrdddd RRRReeeeffffuuuussssaaaallllssss 
Due to the high incidence of fraud with foreign transactions, many legitimate overseas transactions are falsely 
iiddeennttiiffiieedd aass ffrraauudduulleenntt aanndd ddeecclliinneedd. PPrroovviiddiinngg tthhee CCuussttoommeerr wwiitthh tthhee ccoouunnttrryy tthhaatt tthhee uusseerr’’ss mmoobbiillee pphhoonnee iiss 
currently located in will allow them to better manage risk while approving more foreign transactions occurring in 
the same country as the user’s mobile phone. 
9
Service SSSeeerrrvvviiiccceee DDDDeeeelllliiiivvvveeeerrrryyyy PPPPllllaaaattttffffoooorrrrmmmm 
Fraud Prevention Service using SDP Assets 
EEEExxxxppppoooossssuuuurrrreeee LLLLaaaayyyyeeeerrrr 
RRRREEEESSSSTTTT AAAAPPPPIIIIssss ((((HHHHTTTTTTTTPPPPssss)))) 
BBBBBBBBaaaaaaaannnnnnnnkkkkkkkkssssssss aaaaaaaannnnnnnndddddddd CCCCCCCCrrrrrrrreeeeeeeeddddddddiiiiiiiitttttttt////////DDDDDDDDeeeeeeeebbbbbbbbiiiiiiiitttttttt CCCCCCCCaaaaaaaarrrrrrrrdddddddd IIIIIIIIssssssssssssssssuuuuuuuueeeeeeeerrrrrrrrssssssss ((((((((DDDDDDDDaaaaaaaattttttttaaaaaaaa CCCCCCCCoooooooonnnnnnnnttttttttrrrrrrrroooooooolllllllllllllllleeeeeeeerrrrrrrrssssssss)))))))) 
AAAAAAAAggggggggggggggggrrrrrrrreeeeeeeeggggggggaaaaaaaattttttttoooooooorrrrrrrrssssssss (((((((( DDDDDDDDaaaaaaaattttttttaaaaaaaa PPPPPPPPrrrrrrrroooooooocccccccceeeeeeeessssssssssssssssoooooooorrrrrrrrssssssss )) 
Location Push 
API 
Consent API 
GSMA SMS 
API 
Consent 
Management 
Push Location 
Updates 
Send SMS 
Notifications (Optional) 
Location Pull 
API 
Get Location 
(Optional) 
10 
SSSSSSSSeeeeeeeerrrrrrrrvvvvvvvviiiiiiiicccccccceeeeeeee LLLLLLLLaaaaaaaayyyyyyyyeeeeeeeerrrrrrrr 
Consent Database 
IIIIIIIInnnnnnnntttttttteeeeeeeerrrrrrrrnnnnnnnnaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnaaaaaaaallllllll IIIIIIIInnnnnnnntttttttteeeeeeeeggggggggrrrrrrrraaaaaaaattttttttiiiiiiiioooooooonnnnnnnn LLLLLLLLaaaaaaaayyyyyyyyeeeeeeeerrrrrrrr 
NNNNNNNNaaaaaaaattttttttccccccccoooooooossssssss//OOOOOOOOppppppppccccccccoooooooossssssss 
IIddeennttiittyy CCoonnsseenntt 
SMPP (or similar) Location Updates 
(visited/home country) 
SMS-C Location GW CRM 
CCuussttoommeerr PPrrooffiillee 
Customer Lifecycle Events 
TThhiirrdd PPaarrttyy AAAAAA 
PPoolliiccyy EEnnffoorrcceemmeenntt TThhrroottttlliinngg 
NNoottiiffiiccaattiioonnss DDaattaa PPrrootteeccttiioonn 
TTTTTTTThhhhhhhhiiiiiiiirrrrrrrrdddddddd PPPPPPPPaaaaaaaarrrrrrrrttttttttyyyyyyyy OOOOOOOOnnnnnnnn--BBBBBBBBooooooooaaaaaaaarrrrrrrrddddddddiiiiiiiinnnnnnnngggggggg 
FFFFFFFFiiiiiiiinnnnnnnnaaaaaaaannnnnnnncccccccciiiiiiiiaaaaaaaallllllll SSSSSSSSeeeeeeeettttttttttttttttlllllllleeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt 
SSSSSSSSeeeeeeeerrrrrrrrvvvvvvvviiiiiiiicccccccceeeeeeee MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt 
AAAAAAAAnnnnnnnnaaaaaaaallllllllyyyyyyyyttttttttiiiiiiiiccccccccssssssss
Key Learnings from the Case Study
Business Models with Aggregators 
Usual business models apply here 
1. Revenue share model between operators and aggregators 
2. Some aggregators are willing to pay a flat fee for unlimited usage of location 
information to support multiple partners ( e.g. banks) 
3. Certain aggregators prefer exclusivity for working with operators iinn cceerrttaaiinn mmaarrkkeett 
12
Technical aspects 
1. Latency requirements are challenging – 300 milliseconds to retrieve the location of 
registered customer mobile number 
2. Pushing the location data proactively (when customer registers in a roaming network) is 
probably the best option to ensure last known location is available at the time of credit 
card transaction 
3. Data Processors (aggregators) do not need to store the real network iiddeennttiittyy ((ii.ee. 
MSISDN) of the customer and shall store hashed identity for auditing, settlement and 
operational purposes. Operators may need to agree on a common mechanism to 
generate a one-way hash to support customer care processes 
13
Compliance to Data Privacy is the key .... 
1. And specially in Germany from the customer point of view 
2. Customer consent for sharing the location data must be in place but operators do not 
necessarily have to acquire it if banks have acquired it 
3. Aggregators are playing a key role in terms of integrating banks to operators and 
defined as “Data Processors” in terms of legal terms 
4. Major effort is getting the access to the customer data from the underlying NATCO 
systems 
14
Summary – Take aways
Recap – Take aways 
1. Money is not in the APIs but in the specific industry solutions where APIs become 
relevant. 
2. Work closely with vertical industries and build bespoke solutions for well known 
services like Identity, Location as well as well as new areas like WebRTC to identify the 
unique value Telcos can provide in a certain context 
3. Most of the operators have spent lot of money in long-tail developer programs. 
Operators need to engage long tail developers for innovation but focus on enterprises 
for monetization of operator’s assets 
16
THANK YOU! 
QA ?

More Related Content

What's hot

High-Velocity Innovation with AWS
High-Velocity Innovation with AWSHigh-Velocity Innovation with AWS
High-Velocity Innovation with AWSAmazon Web Services
 
Getting the Most Out of Your Data - Segmenting Your Mobile Money Customer Bas...
Getting the Most Out of Your Data - Segmenting Your Mobile Money Customer Bas...Getting the Most Out of Your Data - Segmenting Your Mobile Money Customer Bas...
Getting the Most Out of Your Data - Segmenting Your Mobile Money Customer Bas...GSMA Mobile for Development
 
Getting Radical with Public Sector Digital Transformation
Getting Radical with Public Sector Digital TransformationGetting Radical with Public Sector Digital Transformation
Getting Radical with Public Sector Digital TransformationCapgemini
 
Qubic-Information-Pack-and-Digital-Transformation-Checklist
Qubic-Information-Pack-and-Digital-Transformation-ChecklistQubic-Information-Pack-and-Digital-Transformation-Checklist
Qubic-Information-Pack-and-Digital-Transformation-ChecklistMatthew Lambert
 
Linkedin CME Pitch
Linkedin CME PitchLinkedin CME Pitch
Linkedin CME PitchDavid Homer
 
Insurance Technology Trends 2021
Insurance Technology Trends 2021Insurance Technology Trends 2021
Insurance Technology Trends 2021insureedge
 
Superfast or superfit? The case for UK broadband policy reform
Superfast or superfit? The case for UK broadband policy reformSuperfast or superfit? The case for UK broadband policy reform
Superfast or superfit? The case for UK broadband policy reformMartin Geddes
 
HOSTING 2020 Vision - Art Zeile CEO
HOSTING 2020 Vision - Art Zeile CEO HOSTING 2020 Vision - Art Zeile CEO
HOSTING 2020 Vision - Art Zeile CEO Hostway|HOSTING
 
The Digital Shift in Financial Services
The Digital Shift in Financial ServicesThe Digital Shift in Financial Services
The Digital Shift in Financial ServicesTrustmarque
 
Digital Insurance Transformation
Digital Insurance TransformationDigital Insurance Transformation
Digital Insurance TransformationPaul de Bruijn
 
Rethinking the Telcos business models in the age of 5G - Carlos LOPEZ, Telefó...
Rethinking the Telcos business models in the age of 5G - Carlos LOPEZ, Telefó...Rethinking the Telcos business models in the age of 5G - Carlos LOPEZ, Telefó...
Rethinking the Telcos business models in the age of 5G - Carlos LOPEZ, Telefó...IDATE DigiWorld
 
The Impact of Blockchain on Financial Services
The Impact of Blockchain on Financial ServicesThe Impact of Blockchain on Financial Services
The Impact of Blockchain on Financial ServicesICFAIEDGE
 
Accenture Tech Vision 2020 - Trend 1
Accenture Tech Vision 2020 - Trend 1Accenture Tech Vision 2020 - Trend 1
Accenture Tech Vision 2020 - Trend 1accenture
 
Insurance Technology As A Catalyst For Change - Emerging Market Segments
Insurance Technology As A Catalyst For Change - Emerging Market SegmentsInsurance Technology As A Catalyst For Change - Emerging Market Segments
Insurance Technology As A Catalyst For Change - Emerging Market SegmentsAgile Financial Technologies
 
Παναγιώτης Μαστρογιάννης, 6th Digital Banking Forum
Παναγιώτης Μαστρογιάννης, 6th Digital Banking ForumΠαναγιώτης Μαστρογιάννης, 6th Digital Banking Forum
Παναγιώτης Μαστρογιάννης, 6th Digital Banking ForumStarttech Ventures
 
Improve customer experience with supercomputers
Improve customer experience with supercomputersImprove customer experience with supercomputers
Improve customer experience with supercomputersIBM Sverige
 

What's hot (20)

High-Velocity Innovation with AWS
High-Velocity Innovation with AWSHigh-Velocity Innovation with AWS
High-Velocity Innovation with AWS
 
Getting the Most Out of Your Data - Segmenting Your Mobile Money Customer Bas...
Getting the Most Out of Your Data - Segmenting Your Mobile Money Customer Bas...Getting the Most Out of Your Data - Segmenting Your Mobile Money Customer Bas...
Getting the Most Out of Your Data - Segmenting Your Mobile Money Customer Bas...
 
Getting Radical with Public Sector Digital Transformation
Getting Radical with Public Sector Digital TransformationGetting Radical with Public Sector Digital Transformation
Getting Radical with Public Sector Digital Transformation
 
Qubic-Information-Pack-and-Digital-Transformation-Checklist
Qubic-Information-Pack-and-Digital-Transformation-ChecklistQubic-Information-Pack-and-Digital-Transformation-Checklist
Qubic-Information-Pack-and-Digital-Transformation-Checklist
 
Linkedin CME Pitch
Linkedin CME PitchLinkedin CME Pitch
Linkedin CME Pitch
 
Insurance Technology Trends 2021
Insurance Technology Trends 2021Insurance Technology Trends 2021
Insurance Technology Trends 2021
 
PTH Communications
PTH Communications PTH Communications
PTH Communications
 
Qube case study 2015
Qube case study 2015Qube case study 2015
Qube case study 2015
 
Superfast or superfit? The case for UK broadband policy reform
Superfast or superfit? The case for UK broadband policy reformSuperfast or superfit? The case for UK broadband policy reform
Superfast or superfit? The case for UK broadband policy reform
 
Horizons 2013 IT Magazine
Horizons 2013 IT MagazineHorizons 2013 IT Magazine
Horizons 2013 IT Magazine
 
HOSTING 2020 Vision - Art Zeile CEO
HOSTING 2020 Vision - Art Zeile CEO HOSTING 2020 Vision - Art Zeile CEO
HOSTING 2020 Vision - Art Zeile CEO
 
The Digital Shift in Financial Services
The Digital Shift in Financial ServicesThe Digital Shift in Financial Services
The Digital Shift in Financial Services
 
Digital Insurance Transformation
Digital Insurance TransformationDigital Insurance Transformation
Digital Insurance Transformation
 
Rethinking the Telcos business models in the age of 5G - Carlos LOPEZ, Telefó...
Rethinking the Telcos business models in the age of 5G - Carlos LOPEZ, Telefó...Rethinking the Telcos business models in the age of 5G - Carlos LOPEZ, Telefó...
Rethinking the Telcos business models in the age of 5G - Carlos LOPEZ, Telefó...
 
The Impact of Blockchain on Financial Services
The Impact of Blockchain on Financial ServicesThe Impact of Blockchain on Financial Services
The Impact of Blockchain on Financial Services
 
Accenture Tech Vision 2020 - Trend 1
Accenture Tech Vision 2020 - Trend 1Accenture Tech Vision 2020 - Trend 1
Accenture Tech Vision 2020 - Trend 1
 
Insurance Technology As A Catalyst For Change - Emerging Market Segments
Insurance Technology As A Catalyst For Change - Emerging Market SegmentsInsurance Technology As A Catalyst For Change - Emerging Market Segments
Insurance Technology As A Catalyst For Change - Emerging Market Segments
 
Παναγιώτης Μαστρογιάννης, 6th Digital Banking Forum
Παναγιώτης Μαστρογιάννης, 6th Digital Banking ForumΠαναγιώτης Μαστρογιάννης, 6th Digital Banking Forum
Παναγιώτης Μαστρογιάννης, 6th Digital Banking Forum
 
Jamcracker
JamcrackerJamcracker
Jamcracker
 
Improve customer experience with supercomputers
Improve customer experience with supercomputersImprove customer experience with supercomputers
Improve customer experience with supercomputers
 

Viewers also liked

Capgemini Digital Reference Architecture with HPE
Capgemini Digital Reference Architecture with HPECapgemini Digital Reference Architecture with HPE
Capgemini Digital Reference Architecture with HPECapgemini
 
Next Generation Enterprise Architecture
Next Generation Enterprise ArchitectureNext Generation Enterprise Architecture
Next Generation Enterprise ArchitectureRichard Veryard
 
Enterprise architecture for telecom sector
Enterprise architecture for telecom sectorEnterprise architecture for telecom sector
Enterprise architecture for telecom sectorSoham Pablo
 
IET NW Region - Payment Hub Design
IET NW Region - Payment Hub DesignIET NW Region - Payment Hub Design
IET NW Region - Payment Hub DesignGary Farrow
 
Telecom 2020: Preparing for a very different future
Telecom 2020: Preparing for a very different futureTelecom 2020: Preparing for a very different future
Telecom 2020: Preparing for a very different futureRob Van Den Dam
 
Building a Digital Enterprise: Learning from Experience
Building a Digital Enterprise: Learning from ExperienceBuilding a Digital Enterprise: Learning from Experience
Building a Digital Enterprise: Learning from ExperienceAsanka Abeysinghe
 
Zeta Architecture: The Next Generation Big Data Architecture
Zeta Architecture: The Next Generation Big Data ArchitectureZeta Architecture: The Next Generation Big Data Architecture
Zeta Architecture: The Next Generation Big Data ArchitectureMapR Technologies
 
Next Generation Enterprise Architecture
Next Generation Enterprise ArchitectureNext Generation Enterprise Architecture
Next Generation Enterprise ArchitectureMapR Technologies
 
A Digital Marketing Platform Strategy
A Digital Marketing Platform StrategyA Digital Marketing Platform Strategy
A Digital Marketing Platform StrategyMartin Walsh
 
Global telecom trends by 2020
Global telecom trends by 2020Global telecom trends by 2020
Global telecom trends by 2020Ashutosh Pandey
 
Platform for Digital Transformation
Platform for Digital TransformationPlatform for Digital Transformation
Platform for Digital TransformationAsanka Abeysinghe
 

Viewers also liked (11)

Capgemini Digital Reference Architecture with HPE
Capgemini Digital Reference Architecture with HPECapgemini Digital Reference Architecture with HPE
Capgemini Digital Reference Architecture with HPE
 
Next Generation Enterprise Architecture
Next Generation Enterprise ArchitectureNext Generation Enterprise Architecture
Next Generation Enterprise Architecture
 
Enterprise architecture for telecom sector
Enterprise architecture for telecom sectorEnterprise architecture for telecom sector
Enterprise architecture for telecom sector
 
IET NW Region - Payment Hub Design
IET NW Region - Payment Hub DesignIET NW Region - Payment Hub Design
IET NW Region - Payment Hub Design
 
Telecom 2020: Preparing for a very different future
Telecom 2020: Preparing for a very different futureTelecom 2020: Preparing for a very different future
Telecom 2020: Preparing for a very different future
 
Building a Digital Enterprise: Learning from Experience
Building a Digital Enterprise: Learning from ExperienceBuilding a Digital Enterprise: Learning from Experience
Building a Digital Enterprise: Learning from Experience
 
Zeta Architecture: The Next Generation Big Data Architecture
Zeta Architecture: The Next Generation Big Data ArchitectureZeta Architecture: The Next Generation Big Data Architecture
Zeta Architecture: The Next Generation Big Data Architecture
 
Next Generation Enterprise Architecture
Next Generation Enterprise ArchitectureNext Generation Enterprise Architecture
Next Generation Enterprise Architecture
 
A Digital Marketing Platform Strategy
A Digital Marketing Platform StrategyA Digital Marketing Platform Strategy
A Digital Marketing Platform Strategy
 
Global telecom trends by 2020
Global telecom trends by 2020Global telecom trends by 2020
Global telecom trends by 2020
 
Platform for Digital Transformation
Platform for Digital TransformationPlatform for Digital Transformation
Platform for Digital Transformation
 

Similar to Role of Service Delivery Platforms in Financial Industry

Blood Donors and Receivers Management System
Blood Donors and Receivers Management SystemBlood Donors and Receivers Management System
Blood Donors and Receivers Management SystemIRJET Journal
 
IRJET- High Responsive Smart Parking System using IoT
IRJET- High Responsive Smart Parking System using IoTIRJET- High Responsive Smart Parking System using IoT
IRJET- High Responsive Smart Parking System using IoTIRJET Journal
 
Taming the regulatory tiger with jwg and smartlogic
Taming the regulatory tiger with jwg and smartlogicTaming the regulatory tiger with jwg and smartlogic
Taming the regulatory tiger with jwg and smartlogicAnn Kelly
 
bigdataembeddediotreportvk
bigdataembeddediotreportvkbigdataembeddediotreportvk
bigdataembeddediotreportvkVipul Kaushik
 
Rapport européen sur le Big Data et le RGPD relayé par l'ACPR et l'AMF
Rapport européen sur le Big Data et le RGPD relayé par l'ACPR et l'AMFRapport européen sur le Big Data et le RGPD relayé par l'ACPR et l'AMF
Rapport européen sur le Big Data et le RGPD relayé par l'ACPR et l'AMFSociété Tripalio
 
Heuristic Algorithm using Internet of Things and Mobility for solving demogra...
Heuristic Algorithm using Internet of Things and Mobility for solving demogra...Heuristic Algorithm using Internet of Things and Mobility for solving demogra...
Heuristic Algorithm using Internet of Things and Mobility for solving demogra...Eswar Publications
 
An API Model for Open Banking Eco-Systems
An API Model for Open Banking Eco-SystemsAn API Model for Open Banking Eco-Systems
An API Model for Open Banking Eco-SystemsGary Farrow
 
IIOT on Variable Frequency Drives
IIOT on Variable Frequency DrivesIIOT on Variable Frequency Drives
IIOT on Variable Frequency Drivesmuthamizh adhithan
 
How Manufacturers Can Unlock Business Value via IoT Analytics
How Manufacturers Can Unlock Business Value via IoT AnalyticsHow Manufacturers Can Unlock Business Value via IoT Analytics
How Manufacturers Can Unlock Business Value via IoT AnalyticsCognizant
 
IRJET - Home Appliance Rental Application
IRJET - Home Appliance Rental ApplicationIRJET - Home Appliance Rental Application
IRJET - Home Appliance Rental ApplicationIRJET Journal
 
OUT-OF-THE-BOX INTEROPERABLE COMPONENTS FOR THE DESIGN OF DIGITAL MEDIA ARCHI...
OUT-OF-THE-BOX INTEROPERABLE COMPONENTS FOR THE DESIGN OF DIGITAL MEDIA ARCHI...OUT-OF-THE-BOX INTEROPERABLE COMPONENTS FOR THE DESIGN OF DIGITAL MEDIA ARCHI...
OUT-OF-THE-BOX INTEROPERABLE COMPONENTS FOR THE DESIGN OF DIGITAL MEDIA ARCHI...FIAT/IFTA
 
SOC 2 presentation. Overview of SOC 2 assessment
SOC 2 presentation. Overview of SOC 2 assessmentSOC 2 presentation. Overview of SOC 2 assessment
SOC 2 presentation. Overview of SOC 2 assessmentModu9
 
High-Frequency Trading in Stock Market
High-Frequency Trading in Stock MarketHigh-Frequency Trading in Stock Market
High-Frequency Trading in Stock MarketIRJET Journal
 
The IDMP Challenge - Whitepaper on ISO IDMP by Cunesoft
The IDMP Challenge - Whitepaper on ISO IDMP by CunesoftThe IDMP Challenge - Whitepaper on ISO IDMP by Cunesoft
The IDMP Challenge - Whitepaper on ISO IDMP by CunesoftV E R A
 
Sungard_Digital_September2015_FINAL
Sungard_Digital_September2015_FINALSungard_Digital_September2015_FINAL
Sungard_Digital_September2015_FINALRobert Rosenberg
 
SOA Open Source Implementation | Torry Harris Whitepaper
SOA Open Source Implementation | Torry Harris WhitepaperSOA Open Source Implementation | Torry Harris Whitepaper
SOA Open Source Implementation | Torry Harris WhitepaperTorry Harris Business Solutions
 
GSC Platform pitch
GSC Platform pitchGSC Platform pitch
GSC Platform pitchGSC Platform
 
The larger picture – an icao update
The larger picture – an icao updateThe larger picture – an icao update
The larger picture – an icao updatealban_sylaj
 
White paper-iop tech1
White paper-iop tech1White paper-iop tech1
White paper-iop tech1ali tajalli
 

Similar to Role of Service Delivery Platforms in Financial Industry (20)

Blood Donors and Receivers Management System
Blood Donors and Receivers Management SystemBlood Donors and Receivers Management System
Blood Donors and Receivers Management System
 
IRJET- High Responsive Smart Parking System using IoT
IRJET- High Responsive Smart Parking System using IoTIRJET- High Responsive Smart Parking System using IoT
IRJET- High Responsive Smart Parking System using IoT
 
Taming the regulatory tiger with jwg and smartlogic
Taming the regulatory tiger with jwg and smartlogicTaming the regulatory tiger with jwg and smartlogic
Taming the regulatory tiger with jwg and smartlogic
 
bigdataembeddediotreportvk
bigdataembeddediotreportvkbigdataembeddediotreportvk
bigdataembeddediotreportvk
 
Rapport européen sur le Big Data et le RGPD relayé par l'ACPR et l'AMF
Rapport européen sur le Big Data et le RGPD relayé par l'ACPR et l'AMFRapport européen sur le Big Data et le RGPD relayé par l'ACPR et l'AMF
Rapport européen sur le Big Data et le RGPD relayé par l'ACPR et l'AMF
 
Heuristic Algorithm using Internet of Things and Mobility for solving demogra...
Heuristic Algorithm using Internet of Things and Mobility for solving demogra...Heuristic Algorithm using Internet of Things and Mobility for solving demogra...
Heuristic Algorithm using Internet of Things and Mobility for solving demogra...
 
An API Model for Open Banking Eco-Systems
An API Model for Open Banking Eco-SystemsAn API Model for Open Banking Eco-Systems
An API Model for Open Banking Eco-Systems
 
IIOT on Variable Frequency Drives
IIOT on Variable Frequency DrivesIIOT on Variable Frequency Drives
IIOT on Variable Frequency Drives
 
What is IHAN® project all about in technical matter?
What is IHAN® project all about in technical matter?What is IHAN® project all about in technical matter?
What is IHAN® project all about in technical matter?
 
How Manufacturers Can Unlock Business Value via IoT Analytics
How Manufacturers Can Unlock Business Value via IoT AnalyticsHow Manufacturers Can Unlock Business Value via IoT Analytics
How Manufacturers Can Unlock Business Value via IoT Analytics
 
IRJET - Home Appliance Rental Application
IRJET - Home Appliance Rental ApplicationIRJET - Home Appliance Rental Application
IRJET - Home Appliance Rental Application
 
OUT-OF-THE-BOX INTEROPERABLE COMPONENTS FOR THE DESIGN OF DIGITAL MEDIA ARCHI...
OUT-OF-THE-BOX INTEROPERABLE COMPONENTS FOR THE DESIGN OF DIGITAL MEDIA ARCHI...OUT-OF-THE-BOX INTEROPERABLE COMPONENTS FOR THE DESIGN OF DIGITAL MEDIA ARCHI...
OUT-OF-THE-BOX INTEROPERABLE COMPONENTS FOR THE DESIGN OF DIGITAL MEDIA ARCHI...
 
SOC 2 presentation. Overview of SOC 2 assessment
SOC 2 presentation. Overview of SOC 2 assessmentSOC 2 presentation. Overview of SOC 2 assessment
SOC 2 presentation. Overview of SOC 2 assessment
 
High-Frequency Trading in Stock Market
High-Frequency Trading in Stock MarketHigh-Frequency Trading in Stock Market
High-Frequency Trading in Stock Market
 
The IDMP Challenge - Whitepaper on ISO IDMP by Cunesoft
The IDMP Challenge - Whitepaper on ISO IDMP by CunesoftThe IDMP Challenge - Whitepaper on ISO IDMP by Cunesoft
The IDMP Challenge - Whitepaper on ISO IDMP by Cunesoft
 
Sungard_Digital_September2015_FINAL
Sungard_Digital_September2015_FINALSungard_Digital_September2015_FINAL
Sungard_Digital_September2015_FINAL
 
SOA Open Source Implementation | Torry Harris Whitepaper
SOA Open Source Implementation | Torry Harris WhitepaperSOA Open Source Implementation | Torry Harris Whitepaper
SOA Open Source Implementation | Torry Harris Whitepaper
 
GSC Platform pitch
GSC Platform pitchGSC Platform pitch
GSC Platform pitch
 
The larger picture – an icao update
The larger picture – an icao updateThe larger picture – an icao update
The larger picture – an icao update
 
White paper-iop tech1
White paper-iop tech1White paper-iop tech1
White paper-iop tech1
 

Recently uploaded

New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024BookNet Canada
 
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc
 
SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024Lorenzo Miniero
 
Dev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebDev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebUiPathCommunity
 
Time Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directionsTime Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directionsNathaniel Shimoni
 
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxMerck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxLoriGlavin3
 
Visualising and forecasting stocks using Dash
Visualising and forecasting stocks using DashVisualising and forecasting stocks using Dash
Visualising and forecasting stocks using Dashnarutouzumaki53779
 
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxDigital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxLoriGlavin3
 
Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!Manik S Magar
 
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024BookNet Canada
 
Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Commit University
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 3652toLead Limited
 
Rise of the Machines: Known As Drones...
Rise of the Machines: Known As Drones...Rise of the Machines: Known As Drones...
Rise of the Machines: Known As Drones...Rick Flair
 
What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024Stephanie Beckett
 
The Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsThe Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsPixlogix Infotech
 
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024BookNet Canada
 
DSPy a system for AI to Write Prompts and Do Fine Tuning
DSPy a system for AI to Write Prompts and Do Fine TuningDSPy a system for AI to Write Prompts and Do Fine Tuning
DSPy a system for AI to Write Prompts and Do Fine TuningLars Bell
 
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...AliaaTarek5
 
What is DBT - The Ultimate Data Build Tool.pdf
What is DBT - The Ultimate Data Build Tool.pdfWhat is DBT - The Ultimate Data Build Tool.pdf
What is DBT - The Ultimate Data Build Tool.pdfMounikaPolabathina
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity PlanDatabarracks
 

Recently uploaded (20)

New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
 
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
 
SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024
 
Dev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebDev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio Web
 
Time Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directionsTime Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directions
 
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxMerck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
 
Visualising and forecasting stocks using Dash
Visualising and forecasting stocks using DashVisualising and forecasting stocks using Dash
Visualising and forecasting stocks using Dash
 
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxDigital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
 
Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!
 
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
 
Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365
 
Rise of the Machines: Known As Drones...
Rise of the Machines: Known As Drones...Rise of the Machines: Known As Drones...
Rise of the Machines: Known As Drones...
 
What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024
 
The Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsThe Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and Cons
 
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
 
DSPy a system for AI to Write Prompts and Do Fine Tuning
DSPy a system for AI to Write Prompts and Do Fine TuningDSPy a system for AI to Write Prompts and Do Fine Tuning
DSPy a system for AI to Write Prompts and Do Fine Tuning
 
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
(How to Program) Paul Deitel, Harvey Deitel-Java How to Program, Early Object...
 
What is DBT - The Ultimate Data Build Tool.pdf
What is DBT - The Ultimate Data Build Tool.pdfWhat is DBT - The Ultimate Data Build Tool.pdf
What is DBT - The Ultimate Data Build Tool.pdf
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity Plan
 

Role of Service Delivery Platforms in Financial Industry

  • 1. Role of Service Delivery Platforms in RRRooollleee ooofff SSSeeerrrvvviiiccceee DDDeeellliiivvveeerrryyy PPPlllaaatttfffooorrrmmmsss iiinnn FFFFiiiinnnnaaaannnncccciiiiaaaallll IIIInnnndddduuuussssttttrrrryyyy Rehman Adil Senior Solutions Architect Deutsche Telekom, UK 10th Annual Service Delivery Innovation Summit 16th-17th September 2014 Thistle Marble Arch, London
  • 2. What I am going to talk about How we define Service Delivery Platforms in Telco 2.0 Context Becoming Part of the Financial Industry Eco-system – Case Study Key Learning from Case Study Summary – Take aways 1
  • 3. How we define Service Delivery Platforms in Telco 2.0 Context
  • 4. Telco 2.0 - Two Sided Business Model 3
  • 5. What does Telco have ? 24.09.2014 4
  • 6. Service Delivery Platform - Assets Operator Billing Video Content Delivery Mobile Advertising Government Services Enterprise Solutions Cross Operator Initiatives Vertical Industry Solutions 5 Communications Messaging Multimedia Voice Conference Context Identity Location Presence Profile Access QoS Policy Bearer Security Commerce Payments Rating Subscriptions Settlement Over-The-Top Social Login Aggregators Partners Hubs Solution Enablement Layer
  • 7. Digital Services Reference Architecture SSSSSSSSeeeeeeeerrrrrrrrvvvvvvvviiiiiiiicccccccceeeeeeee LLLLLLLLaaaaaaaayyyyyyyyeeeeeeeerrrrrrrr EEEExxxxppppoooossssuuuurrrreeee LLLLaaaayyyyeeeerrrr LLLLaaaayyyyeeeerrrr Third Party On-Boarding Micro Location API WebRTC /Joyn Network API Delegated Operator Authentication Payments API Subscriptions API Customer Profile API Social Login Page/ OpenID Operator Identification API QoS API Short Messaging API Customer Identity API Cell-ID Location API Roaming API Voice call API Mobile ID API Natural Language Understanding API LTE Location API SSeerrvviiccee LLaayyeerr FFuunnccttiioonnaall DDoommaaiinnss SSeerrvviiccee LLaayyeerr CChhaarraacctteerriissttiiccss CCuussttoommeerr PPrrooffiillee IIddeennttiittyy OOppeerraattoorr DDiissccoovveerryy QQooSS SSuubbssccrriippttiioonnss PPaayymmeennttss SSeerrvviiccee OOrrcchheessttrraattiioonn RRuullee--BBaasseedd RRoouuttiinngg Fault and Performance Monitoring TTrraaffffiicc DDiissttrriibbuuttiioonn TThhiirrdd PPaarrttyy AAAAAA OOppeerraattiioonnaall LLooggggiinngg Consent API FFiinnaanncciiaall SSeettttlleemmeenntt SSeerrvviiccee MMaannaaggeemmeenntt AAnnaallyyttiiccss // BBiigg DDaattaa 6 PPoolliiccyy EEnnffoorrcceemmeenntt TThhrroottttlliinngg DDaattaa PPrrootteeccttiioonn IInntteerrnnaattiioonnaall IInntteeggrraattiioonn LLaayyeerr SSeerrvviiccee EEnnaabblleerrss// DDiiggiittaall AAsssseettss//OOTTTT NNAATTCCOO IITT EEnnaabblleerrss CChhaarrggiinngg RRaattiinngg SSuubbssccrriippttiioonnss AAlllloowwaanncceess//VVoouucchheerrss FFuullllffiillllmmeenntt CCuussttoommeerr PPrrooffiillee CCuussttoommeerr LLiiffeeccyyccllee PPrroodduucctt OOffffeerrss//CCaattaalloogguuee NNAATTCCOO NNTT EEnnaabblleerrss OOTTTT EEnnaabblleerrss CCuussttoommeerr LLooccaattiioonn IIMMSS JJooyynn DDTT OOTTTT IIDD PPrroovviiddeerr GGlloobbaall MMSSIISSDDNN DDaattaabbaassee PPoolliiccyy FFuunnccttiioonn MMeessssaaggiinngg OOTTTT MMeessssaaggiinngg OOTTTT CCoommmmuunniiccaattiioonn CClloouudd OOTTTT aanndd NNoonn--OOppeerraattoorr BBiilllliinngg CCuussttoommeerr NNeettwwoorrkk IIddeennttiittyy OOTTTT SSuubbssccrriippttiioonnss OOTTTT LLooccaattiioonn BBuussiinneessss LLooggggiinngg MMeessssaaggiinngg CCoommmmuunniiccaattiioonn Delegated Authentication LLooccaattiioonn CCoonnsseenntt PPrroottooccooll AAbbssttrraaccttiioonn NNoottiiffiiccaattiioonnss QQuueeuuiinngg aanndd SSttaaggiinngg
  • 8. Becoming Part of Financial Industry Eco-System – Case Study
  • 9. FRAUD PREVENTION SOLUTION FOR CROSS BORDER TRANSACTIONS Your Location Your Credit Card 8 With your GSM/LTE phone and network location API our banking partners can readily check the country location to prevent fraud at a speed needed for financial transactions!
  • 10. Fraud Prevention Service ▪ Two major use cases for cross-border payment card transactions are as follows: – RRRReeeedddduuuucccciiiinnnngggg CCCCrrrroooossssssss-BBBBoooorrrrddddeeeerrrr PPPPaaaayyyymmmmeeeennnntttt CCCCaaaarrrrdddd FFFFrrrraaaauuuudddd A significant amount of payment card fraud occurs with transactions originating in countries other than the cardholder’s own. Providing the Customer with the country that the user’s mobile phone is currently located in will allow them to more accurately determine whether transactions occurring in a foreign country are likely to be fraudulent. – RRRReeeedddduuuucccciiiinnnngggg FFFFaaaallllsssseeee-PPPPoooossssiiiittttiiiivvvveeee PPPPaaaayyyymmmmeeeennnntttt CCCCaaaarrrrdddd RRRReeeeffffuuuussssaaaallllssss Due to the high incidence of fraud with foreign transactions, many legitimate overseas transactions are falsely iiddeennttiiffiieedd aass ffrraauudduulleenntt aanndd ddeecclliinneedd. PPrroovviiddiinngg tthhee CCuussttoommeerr wwiitthh tthhee ccoouunnttrryy tthhaatt tthhee uusseerr’’ss mmoobbiillee pphhoonnee iiss currently located in will allow them to better manage risk while approving more foreign transactions occurring in the same country as the user’s mobile phone. 9
  • 11. Service SSSeeerrrvvviiiccceee DDDDeeeelllliiiivvvveeeerrrryyyy PPPPllllaaaattttffffoooorrrrmmmm Fraud Prevention Service using SDP Assets EEEExxxxppppoooossssuuuurrrreeee LLLLaaaayyyyeeeerrrr RRRREEEESSSSTTTT AAAAPPPPIIIIssss ((((HHHHTTTTTTTTPPPPssss)))) BBBBBBBBaaaaaaaannnnnnnnkkkkkkkkssssssss aaaaaaaannnnnnnndddddddd CCCCCCCCrrrrrrrreeeeeeeeddddddddiiiiiiiitttttttt////////DDDDDDDDeeeeeeeebbbbbbbbiiiiiiiitttttttt CCCCCCCCaaaaaaaarrrrrrrrdddddddd IIIIIIIIssssssssssssssssuuuuuuuueeeeeeeerrrrrrrrssssssss ((((((((DDDDDDDDaaaaaaaattttttttaaaaaaaa CCCCCCCCoooooooonnnnnnnnttttttttrrrrrrrroooooooolllllllllllllllleeeeeeeerrrrrrrrssssssss)))))))) AAAAAAAAggggggggggggggggrrrrrrrreeeeeeeeggggggggaaaaaaaattttttttoooooooorrrrrrrrssssssss (((((((( DDDDDDDDaaaaaaaattttttttaaaaaaaa PPPPPPPPrrrrrrrroooooooocccccccceeeeeeeessssssssssssssssoooooooorrrrrrrrssssssss )) Location Push API Consent API GSMA SMS API Consent Management Push Location Updates Send SMS Notifications (Optional) Location Pull API Get Location (Optional) 10 SSSSSSSSeeeeeeeerrrrrrrrvvvvvvvviiiiiiiicccccccceeeeeeee LLLLLLLLaaaaaaaayyyyyyyyeeeeeeeerrrrrrrr Consent Database IIIIIIIInnnnnnnntttttttteeeeeeeerrrrrrrrnnnnnnnnaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnaaaaaaaallllllll IIIIIIIInnnnnnnntttttttteeeeeeeeggggggggrrrrrrrraaaaaaaattttttttiiiiiiiioooooooonnnnnnnn LLLLLLLLaaaaaaaayyyyyyyyeeeeeeeerrrrrrrr NNNNNNNNaaaaaaaattttttttccccccccoooooooossssssss//OOOOOOOOppppppppccccccccoooooooossssssss IIddeennttiittyy CCoonnsseenntt SMPP (or similar) Location Updates (visited/home country) SMS-C Location GW CRM CCuussttoommeerr PPrrooffiillee Customer Lifecycle Events TThhiirrdd PPaarrttyy AAAAAA PPoolliiccyy EEnnffoorrcceemmeenntt TThhrroottttlliinngg NNoottiiffiiccaattiioonnss DDaattaa PPrrootteeccttiioonn TTTTTTTThhhhhhhhiiiiiiiirrrrrrrrdddddddd PPPPPPPPaaaaaaaarrrrrrrrttttttttyyyyyyyy OOOOOOOOnnnnnnnn--BBBBBBBBooooooooaaaaaaaarrrrrrrrddddddddiiiiiiiinnnnnnnngggggggg FFFFFFFFiiiiiiiinnnnnnnnaaaaaaaannnnnnnncccccccciiiiiiiiaaaaaaaallllllll SSSSSSSSeeeeeeeettttttttttttttttlllllllleeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt SSSSSSSSeeeeeeeerrrrrrrrvvvvvvvviiiiiiiicccccccceeeeeeee MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt AAAAAAAAnnnnnnnnaaaaaaaallllllllyyyyyyyyttttttttiiiiiiiiccccccccssssssss
  • 12. Key Learnings from the Case Study
  • 13. Business Models with Aggregators Usual business models apply here 1. Revenue share model between operators and aggregators 2. Some aggregators are willing to pay a flat fee for unlimited usage of location information to support multiple partners ( e.g. banks) 3. Certain aggregators prefer exclusivity for working with operators iinn cceerrttaaiinn mmaarrkkeett 12
  • 14. Technical aspects 1. Latency requirements are challenging – 300 milliseconds to retrieve the location of registered customer mobile number 2. Pushing the location data proactively (when customer registers in a roaming network) is probably the best option to ensure last known location is available at the time of credit card transaction 3. Data Processors (aggregators) do not need to store the real network iiddeennttiittyy ((ii.ee. MSISDN) of the customer and shall store hashed identity for auditing, settlement and operational purposes. Operators may need to agree on a common mechanism to generate a one-way hash to support customer care processes 13
  • 15. Compliance to Data Privacy is the key .... 1. And specially in Germany from the customer point of view 2. Customer consent for sharing the location data must be in place but operators do not necessarily have to acquire it if banks have acquired it 3. Aggregators are playing a key role in terms of integrating banks to operators and defined as “Data Processors” in terms of legal terms 4. Major effort is getting the access to the customer data from the underlying NATCO systems 14
  • 17. Recap – Take aways 1. Money is not in the APIs but in the specific industry solutions where APIs become relevant. 2. Work closely with vertical industries and build bespoke solutions for well known services like Identity, Location as well as well as new areas like WebRTC to identify the unique value Telcos can provide in a certain context 3. Most of the operators have spent lot of money in long-tail developer programs. Operators need to engage long tail developers for innovation but focus on enterprises for monetization of operator’s assets 16