SlideShare a Scribd company logo
1 of 34
GSTM1 gene Polymorphism in Sporadic
Breast Cancer Patients
Sateesh Chandra Gupta
Overview
 Cancer
 Breast cancer
 sporadic ,familial and hereditary breast cancer
 Types of Breast Cancer
 Stages of Breast cancer
 causes of breast cancer
 Genetic, Environmental, Life style and hormonal factor
 Polymorphism
 Classes of polymorphism
 Role of polymorphism in breast cancer
 glutathione S-transferase (GST)
 Glutathione S-transferase Mu1 ( GST M1)
 Work Flow
 Result
 Reference
BACKGROUND
Cancer
 Cancer is a group of more than 100 disease that developed across
time and involved the uncontrolled cell division of body.
 Cancer are arise from the loss of normal growth control.
 In normal tissue, the rate of new cell growth and old cell death are
balance with the process known as cell division and apoptosis
respectively.
 In cancerous cell this balance is disrupted.
Breast cancer
 Breast cancer is the most common type of cancer (29%) among
women in the world
 An estimated 40,730 breast cancer deaths (40,290 women, 440 men)
are expected in 2015. Breast cancer ranks second as a cause of cancer
death in women (after lung cancer).
 The risk of breast cancer increases with age and most breast cancers
occur after the age of 50.
(America Cancer Society, 2015 )
 Breast Cancer is a malignant tumor that start in the cells of breast.
 A malignant tumor is a group of cancer cells that can grow(invade)
into surrounding tissue or spread (metastasize) nearby area of the
body.
Breast Cancer
The disease occur almost entirely in the women but men also get it.
 Most commonly from inner lining of milk duct or lobules that supply
ducts with milk.
 Cancer originating from duct are known as ductal carcinoma, while
those originating from lobules are known as lobular carcinoma.
Hereditary
Breast cancer
Sporadic Familial
 Approximate 10%
 Clustering within
family.
 Not hereditary
 Early onset than
sporadic cancer.
 Risk factor - same life
style of a family.
 Approximate 85 %
 Late onset
 Risk factor –age
exposure to
environmental
carcinogens,
Hormone and
Lifestyle .
 Approximate 5-7 %.
 Same type of cancer
in the family.
 Early onset.
 Bilateral.
 Having strong
family history.
 results from same
genetic and
environment or
lifestyle factors.
Breast carcinoma
Invasive Breast CarcinomaNon-invasive Breast Carcinoma
Ductal Carcinoma.
Lobular Carcinoma. Invasive Ductal Carcinoma
Invasive Lobular Carcinoma
Inflammatory Carcinoma
Secretary Carcinoma
Tubular Carcinoma
Receptor specific Breast cancer
Receptor
Hormone Receptor
(HR)
Tyrosine Kinase
Receptor
Estrogen Receptor(ER) Progesterone Receptor(PR) HER2 Receptor
ER Positive ER Negative PR Positive PR Negative
HER2 Positive HER2 Negative
Triple Negative Breast Cancer are Estrogen Receptor(ER),
Progesterone Receptor(PR) and Human Epidermal Growth Receptor
2(HER2) negative ,Hence called as triple negative breast cancer
Causes of Breast
Cancer
GENETIC
 The genome is susceptible to damage by both intrinsic( like Cell
division errors) and extrinsic factors(carcinogens and radiations) .
 Certain genes called Tumor Suppressor genes (BRCA1, BRCA2,
TP53, ATM and PTEN) are involved in maintenance of genomic
stability.
 Mutations that impair their function predisposes an individual to
develop cancer.
 Accumulation of mutations causing DNA damage transforms a normal
cell to a cancerous cell.
( Emel Ergul Ali Sajki et al. 2000 )
EnvironmentalFactor
 Natural or synthetic substances in environment that can cause
cancer are called environmental carcinogens.
 Divided into
 Chemical agents - Lead, cobalt, asbestos, nitrosamine and many type
of pesticide.
 Physical agents – X- rays, Gamma rays and Ultraviolet rays
 Light at Night (LAN Hypothesis)
May decrease the synthesis of melatonin- change in melatonin may
affect the level of estrogen and initiate the breast cancer.
(Richard G Stevens 2009)
LIFE STYLE
SMOKING and ALCOHOL DRINKING
 Each cigarette contains a mixture of carcinogens including
polycyclic aromatic hydrocarbons (PAHs), N-nitrosamines, NO2 and
free radicals .
 Cytochrome P-450 enzymes (P-450s) convert the carcinogens to
more reactive forms which bind to DNA and form DNA adduct.
 Alcohol in the body converts into the aldehyde. Acetaldehyde
converts into the Reactive Oxygen Species (ROS),which react with
DNA to form DNA adducts, which may initiate cancer.
 Alcoholic beverage consumption in women also causes an increase in
levels of endogenous estrogens hormone.
Smoke & alcohol carcinogens in cancer..
Metabolic
Activation
Metabolic
Detoxification Repair
Excretion Normal DNA
Uptake of
Smoke &
Alcohol
Carcinogen
DNA
Adduct
Mutation
in DNA
repair
genes and
Tumor -
suppresso
r genes
Loss of
normal
growth
control
mechanis
m
Cancer
HORMONAL
 Estrogens and progesterone are essential hormone for normal breast
development. The main estrogens are estradiol and estrone, as well as
16-hydroxyestradiol (estriol).
Estrone and estradiol
hydroxylated at positions
C2, C4 and C16
(2 hydroxyestrone, 4 hydroxyestrone
2-hydroxyestradiol, and 4-
hydroxyestradiol), and 16a-
hydroxyestrone.
carcinogenic potential by
damaging DNA
Estrogen Catabolism...
COMT GST
CYP450 CYP450 DNA
CYP450 1A2
CYP450 1B1
CYP450 CYP450 DNA
COMT GST
2-Methoxy Estrogens
2-Hydroxy estrogen
Estrogen
E,2,3 semi Q E,2,3 Q
Glutathione Conjugate
4-Hydroxy estrogen E,4,3 semi Q E,4,3 Q DNA Adduct
Glutathione Conjugate4-Methoxy estrogen
CANCER
DNA Adduct
Premenopausal Postmenopausal
Estrogen
Ovaries adipose tissue, muscle
liver
ER
ER
Breast Cancer
Ovarian removal Aromatase Inhibitors
Tamoxifen Tamoxifen
Receptor Mediated Carcinogenesis of Estrogen
xP0LYMORPHISm
 polymorphism is a DNA sequence variation that seen in more than 1%
in normal population. In this case no single allele is regarded as the
standard sequence. There are two or more acceptable alternatives.
Classes of polymorphism
 Single Nucleotide Polymorphisms (SNP): is a genetic variation
when a single nucleotide (i.e., A, T, C, or G) is altered .
 Variable Number of Tandem Repeats or VNTR: is a location on
genome where a short nucleotide sequence organized as tandem repeat.
 Microsatellites or STR or SSR: short tandem repeat (2 – 6 bp long)
 Minisatellites : simple sequence repeats (10 – 40 bp long)
Cont…
Example of SNP
Example of STR
ATCGACTGCGATCATGCATGCATGCATGCATGC
ATGCATGCATGCATGCATGCCTACGTGACTGAC
Here sequence CATG are repeated several times.
Ex. of Minisatellit
CCATCACATATATTCCATATATTCACATATATTACCA
GACTCACATATATTCACATATATTCACATATATTCTA
Here sequence CACATATATT are repeated several times.
C T T C A T C G A T C G G
C T T C A T G G A T C G G
Role of polymorphism in Development of breast cancer
 Polymorphisms consist of minor changes in DNA sequence -modify
the structure, expression or activity of the proteins.
 Polymorphisms in xenobiotic or carcinogenic metabolic genes give
rise to variable enzyme activity - differing abilities in the metabolism
of xenobiotic or carcinogen.
 When the activity of xenobiotic metabolizing enzyme is impaired by
polymorphism it will not metabolize the Xenobiotic and carcinogenic
compound.
 xenobiotic or carcinogenic compounds react with DNA and form the
DNA adduct - causes mutation and initiation of breast cancer.
GlutathioneS-transferase(GST)
 Glutathione S-Transferase (GSTs), is a phase ll xenobiotic detoxifying
enzyme.
 GSTs catalyses the conjugation of glutathione (GSH) to a wide
variety of endogenous and exogenous electrophilic compounds .
Alpha class
Mu Class
Pai Class
Theta Class
Zeta Class
Omega Class
Sigma Class
GSTA1, GSTA2, GSTA3, GSTA4, GSTA5
GSTM1,GSTM2,GSTM3,GSTM4,GSTM5
GST P1
GSTT1, GST T2
GST Z1
GST O1, GST O2
GST S1
Cytosolic
Mitochondrial
Microsomal (MAPEG)
GST
Kappa Class
MGST
GST K1
MGST1, MGST2, MGST3
Glutathione S –Transferase Mu 1 (GST M1)
 Located on chromosome 1p13.3.
Having 8 exons.
Gene size is 5490 bp.
 GSTM1 is polymorphically expressed, and three alleles have been
identified:GSTM1*0,GSTM1a and GSTM1b.
 The GSTM1a and GSTM1b are functionally identical, but differ
by single nucleotide substitution C >G at base position 519 or
position aa173 Lys convert in the asparagine.
 Homologous deletion results in the loss of this gene thus loss of
function of the enzyme.
Blood sample collection
DNA Extraction By Phenol
-Chloroform Method
Genotyping By Multiplex
PCR
Sample loading on 1%
agarose gel
Work Flow
Lymphocytes Separation
Blood sample collection
Lymphocytes Separation
Multiplex PCR- Amplification of many desired DNA fragments.
 We used two sets of primers: IFN gene primer pairs and GSTM1 primer
pairs. IFN primers were used to detect that whether PCR has worked or not.
Condition for PCR
Initial Denaturation Temperature
95 0c For 5 Minutes
Denaturation Temperature
950c for 45 second
Annealing Temperature
600c for 45 second
Extension temperature
720c for 45 second
Final extension temperature
720c 5 minutes
34 cycles
Master Mix for PCR
Component 1X(for One Reaction) nX (for n reaction)
MilliQ water 12.4µl 12.4n µl
10X PCR Buffer (Axygen) 2.5µl 2.5n µl
25mM dNTP 1.0µl 1.0n µl
10pmol IFN (forward Primer)
5′ GGCACAACAGGTAGTAGGCG 3′
1.0µl 1.0n µl
10pmol IFN (Reverse Primer)
5′ GCCACAGGACGTACTGACAC 3
1.0µl 1.0n µl
10pmol GSTM1 (Forward Primer)
5′CTGGATAGTAGCAGATCATGC 3′
1.0µl 1.0n µl
10pmol GSTM1 (Reverse Primer)
5′ CTGCCCTACTTGATTGATGGG 3′
1.0µl 1.0n µl
Sample DNA (20ng/µl) 5.0µl 5.0n µl
Taq. Polymerase (10U/µl) 0.1µl 0.1n µl
100 bp Ladder- 1
Result
Rrrrr
Wild Type Wells- 3, 5
1 2 3 4 5
Null Type Wells-2, 4
GST M1
(273 bp)IFN
(173 bp)
500 bp
1
Result
100 bp Ladder Well -1
Frequency of GST M1 Homozygous Null Genotypes in worldwide Populations
Frequency of GST M1 Homozygous Null Genotypes in ACTREC Cohort
Resultcontd....
GST M1 Joanne E. Curran et al.
Australia (2000)
Christine B. Ambrosone
et al. New York ( 1995)
Samson et al.(2007)
South India
Genotype Null Type Wild Type Null Type Wild Type Null Type Wild Type
SC 56 (43% ) 73 (57% ) 84(48%) 93 (52%) 65(28.3%) 185(71.7%)
SN 57 (44% ) 72 (56% ) 116(50%) 117(50%) 110(22%) 390(78%)
Genotype Case (SC)
180
Control (SN)
188
Odds Ratio 95% CI P Value
Null 68(37.7%) 60(37.3%) 1.0235 0.6710 –
1.5611 P =0.9142Wild 112(62.3%) 118(62.7%)
All the Analytical analysis are calculated by using online software www.medcalc.net
 Correlation of different variable in development of breast cancer
in case and control.
Association between Breast Cancer Risk and Food Preference among Case and
Control population:
Vegetarian OR P Value Non Vegetarian OR P Value
Case Control 1.117
95% CI
0.506 –
2.457
P=0.784
Case Control
0.936
95% CI
0.556 –
1.576
0.803
Null 17 26 45 42
Wild 24 41 87 76
There are no Statistical significance have been found ( OR =1.117, P
=0.784 and OR =0.936, P = 0.803) between Breast cancer case and
healthy control population in ,correlation with food preference
Vegetarian and non Vegetarian Respectively.
 Association between Breast Cancer Risk and Tobacco
consumption Among Case and Control
Tobacco User OR P Value Non User OR P Value
Case Control
0.7955
95% CI
0.2362 -
2.6788
P=0.711
1
case Control
0.9951
95% CI
0.5976–
1.6570
P=0.985
0
Null 7 11 51 41
Wild 12 15 95 76
There are no Statistical significance have been found ( OR =0.7955,
P =0.7111and OR =09951, P = 0.9850) between Breast cancer case
and healthy control population in ,correlation with Tobacco
consumption, tobacco user and non user Respectively.
 Association between Breast Cancer Risk and Menopause status
among Case and Control
Premenopause OR P Value Postmenopause OR P Value
Case Control
0.997
95% CI
0.556 –
1.789
P=0.993
Case Control
0.927
95% CI
0.488 –
1.759
P=0.817
Null 33 39 29 29
Wild 56 66 55 51
There are no Statistical significance have been found ( OR =0.997, P
=0.993 and OR =0.927, P = 0.817) between Breast cancer case and
healthy control population in ,correlation with Menopause
status,premenopause and Postmenopause Respectively.
conclusion
 The frequency of null polymorphism in breast cancer patients and
healthy individual is almost similar (37%) null and wild genotype
frequency (63%).
 Our finding are in coherence with the previously studies
worldwide.
 The present study suggest that ,the null polymorphism in GSTM1
may not be involved in sporadic breast cancer susceptibility, But
have the modifier effect in initiation of breast cancer in
combination with other detoxifying enzyme, like GSTT1,
GSTP1,CYP450,NAT and COMT.
Conclusion cont..
 We also correlate breast cancer case and healthy control with
many variable ,like food preference, Tobacco consumption and
menopause status, but there are no statistical significant value
have been found.
 Further, we need to extend our study in a larger cohort to stabilise the
precise role of null polymorphism in GSTM1 in sporadic breast
cancer susceptibility.
Reference
 Christine B. Ambrosone, Cytochrome P4501A1 and Glutathione S-Transferase
(M1) Genetic Polymorphisms and Postmenopausal Breast Cancer Risk.
 A Khedhaier, Glutathione S-transferases (GSTT1 and GSTM1) gene deletions
inTunisians: susceptibility and prognostic implications in breast carcinoma.
 Joanne E. Curran, Polymorphisms of glutathione S-transferase
genes(GSTM1, GSTP1 and GSTT1) and breast cancer susceptibility
 Hamed Samavat, Estrogen metabolism and breast cancer.
 Stephen S. Hecht, Tobacco smoke carcinogens and breast cancer.
 Ramona G. Dumitrescu, The etiology of alcohol-induced breast cancer
 Alison M. Dunning, A Systematic Review Of Genetic Polymorphisms and Breast
Cancer Risk
 S.Zhong, Relationship between the GSTM1 genetic polymorphism and
susceptibility to bladder, breast and colon cancer
THANK YOU

More Related Content

What's hot

Cancer and cell cycle
Cancer and cell cycleCancer and cell cycle
Cancer and cell cyclejpollack13
 
Molecular Genetics of Cancer
Molecular Genetics of CancerMolecular Genetics of Cancer
Molecular Genetics of CancerNeha Vats
 
Tumour suppressor genes
Tumour suppressor genes Tumour suppressor genes
Tumour suppressor genes Dhanya K C
 
DNA damage and repair
DNA damage and repairDNA damage and repair
DNA damage and repairHadia Azhar
 
Cell cycle dysregulation in cancer
Cell cycle dysregulation in cancerCell cycle dysregulation in cancer
Cell cycle dysregulation in cancerAftab Badshah
 
Molecular structure of genes and chromosomes
Molecular structure of genes and chromosomesMolecular structure of genes and chromosomes
Molecular structure of genes and chromosomesDiptanshu Sinha
 
DNA repair
DNA repair DNA repair
DNA repair arjunKB6
 
agrobacterium transformation
agrobacterium transformationagrobacterium transformation
agrobacterium transformation45013
 
Tumor suppressorgenes
Tumor suppressorgenesTumor suppressorgenes
Tumor suppressorgenesPrasad CSBR
 
Promoter and its types
Promoter and its typesPromoter and its types
Promoter and its typesFawad Kaleem
 
RNA & Protein Synthesis
RNA & Protein SynthesisRNA & Protein Synthesis
RNA & Protein SynthesisKarl Pointer
 
Agrobacterium mediated transformation, its mode of action and applications in...
Agrobacterium mediated transformation, its mode of action and applications in...Agrobacterium mediated transformation, its mode of action and applications in...
Agrobacterium mediated transformation, its mode of action and applications in...Dr. Shobha D. Surbhaiyya
 
Genomic instability and Cancer
Genomic instability and CancerGenomic instability and Cancer
Genomic instability and CancerSurender Rawat
 

What's hot (20)

Cancer and cell cycle
Cancer and cell cycleCancer and cell cycle
Cancer and cell cycle
 
Molecular Genetics of Cancer
Molecular Genetics of CancerMolecular Genetics of Cancer
Molecular Genetics of Cancer
 
Carcinogen
CarcinogenCarcinogen
Carcinogen
 
Tumour suppressor genes
Tumour suppressor genes Tumour suppressor genes
Tumour suppressor genes
 
Tumor Suppressor Gene
Tumor Suppressor GeneTumor Suppressor Gene
Tumor Suppressor Gene
 
DNA damage and repair
DNA damage and repairDNA damage and repair
DNA damage and repair
 
Epigenetic
EpigeneticEpigenetic
Epigenetic
 
Cell cycle dysregulation in cancer
Cell cycle dysregulation in cancerCell cycle dysregulation in cancer
Cell cycle dysregulation in cancer
 
ONCOGENE AND TUMOUR SUPPRESSOR GENE
ONCOGENE AND TUMOUR SUPPRESSOR GENEONCOGENE AND TUMOUR SUPPRESSOR GENE
ONCOGENE AND TUMOUR SUPPRESSOR GENE
 
Molecular structure of genes and chromosomes
Molecular structure of genes and chromosomesMolecular structure of genes and chromosomes
Molecular structure of genes and chromosomes
 
DNA repair
DNA repair DNA repair
DNA repair
 
agrobacterium transformation
agrobacterium transformationagrobacterium transformation
agrobacterium transformation
 
Tumor suppressorgenes
Tumor suppressorgenesTumor suppressorgenes
Tumor suppressorgenes
 
DNA damage and_repair
DNA damage and_repairDNA damage and_repair
DNA damage and_repair
 
Promoter and its types
Promoter and its typesPromoter and its types
Promoter and its types
 
RNA & Protein Synthesis
RNA & Protein SynthesisRNA & Protein Synthesis
RNA & Protein Synthesis
 
Agrobacterium mediated transformation, its mode of action and applications in...
Agrobacterium mediated transformation, its mode of action and applications in...Agrobacterium mediated transformation, its mode of action and applications in...
Agrobacterium mediated transformation, its mode of action and applications in...
 
Genitics of cancer
Genitics of cancerGenitics of cancer
Genitics of cancer
 
Epigenetics
EpigeneticsEpigenetics
Epigenetics
 
Genomic instability and Cancer
Genomic instability and CancerGenomic instability and Cancer
Genomic instability and Cancer
 

Viewers also liked

Patología Molecular Del Cáncer De Mama
Patología Molecular Del Cáncer De MamaPatología Molecular Del Cáncer De Mama
Patología Molecular Del Cáncer De Mamalalfaro
 
Olga staging system for diagnosis of gastritis
Olga staging system for diagnosis of gastritisOlga staging system for diagnosis of gastritis
Olga staging system for diagnosis of gastritisSamir Haffar
 
Chấn thương bụng kín
Chấn thương bụng kínChấn thương bụng kín
Chấn thương bụng kínQuynh Huong
 
Hereditary Cancer Syndrome
Hereditary Cancer SyndromeHereditary Cancer Syndrome
Hereditary Cancer SyndromeSujoy Dasgupta
 

Viewers also liked (7)

Utdd
UtddUtdd
Utdd
 
Patología Molecular Del Cáncer De Mama
Patología Molecular Del Cáncer De MamaPatología Molecular Del Cáncer De Mama
Patología Molecular Del Cáncer De Mama
 
Vdd
VddVdd
Vdd
 
Breast cancer
Breast cancerBreast cancer
Breast cancer
 
Olga staging system for diagnosis of gastritis
Olga staging system for diagnosis of gastritisOlga staging system for diagnosis of gastritis
Olga staging system for diagnosis of gastritis
 
Chấn thương bụng kín
Chấn thương bụng kínChấn thương bụng kín
Chấn thương bụng kín
 
Hereditary Cancer Syndrome
Hereditary Cancer SyndromeHereditary Cancer Syndrome
Hereditary Cancer Syndrome
 

Similar to GSTM1 Gene Polymorphism in Sporadic Breast Cancer Patients

Molecular mechanism of neoplasia
Molecular mechanism of neoplasiaMolecular mechanism of neoplasia
Molecular mechanism of neoplasiaUtkarsh Sharma
 
krascancerpres.ppt
krascancerpres.pptkrascancerpres.ppt
krascancerpres.pptAkamGardy
 
Hormone therapy in breast cancer
Hormone therapy in breast cancerHormone therapy in breast cancer
Hormone therapy in breast cancerRajib Bhattacharjee
 
Biochemistry of cancer ,An overview
Biochemistry of cancer ,An overviewBiochemistry of cancer ,An overview
Biochemistry of cancer ,An overviewgovt of maharastra
 
Molecular basis of head and neck cancer
Molecular basis of head and neck cancerMolecular basis of head and neck cancer
Molecular basis of head and neck cancerSREENIVAS KAMATH
 
Anindya seminar 1 growth factors and cell cycle signalling in pathogenesis of...
Anindya seminar 1 growth factors and cell cycle signalling in pathogenesis of...Anindya seminar 1 growth factors and cell cycle signalling in pathogenesis of...
Anindya seminar 1 growth factors and cell cycle signalling in pathogenesis of...Kazi Manir
 
Cancer Genetics - Denise Sheer
Cancer Genetics - Denise SheerCancer Genetics - Denise Sheer
Cancer Genetics - Denise SheerDenise Sheer
 
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...BioMedSciDirect Publications
 
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...BioMedSciDirect Publications
 
Medical Students 2011 - N. Pavlidis - BREAST CANCER SESSION - Systemic Treatm...
Medical Students 2011 - N. Pavlidis - BREAST CANCER SESSION - Systemic Treatm...Medical Students 2011 - N. Pavlidis - BREAST CANCER SESSION - Systemic Treatm...
Medical Students 2011 - N. Pavlidis - BREAST CANCER SESSION - Systemic Treatm...European School of Oncology
 
Anti Cancer Drugs.pptx
Anti Cancer Drugs.pptxAnti Cancer Drugs.pptx
Anti Cancer Drugs.pptxSwetaMaurya16
 

Similar to GSTM1 Gene Polymorphism in Sporadic Breast Cancer Patients (20)

Lepow Day Poster
Lepow Day PosterLepow Day Poster
Lepow Day Poster
 
Molecular mechanism of neoplasia
Molecular mechanism of neoplasiaMolecular mechanism of neoplasia
Molecular mechanism of neoplasia
 
Neoplasia 6-3-2011
Neoplasia 6-3-2011Neoplasia 6-3-2011
Neoplasia 6-3-2011
 
ajit tumor marker.pptx
ajit tumor marker.pptxajit tumor marker.pptx
ajit tumor marker.pptx
 
krascancerpres.ppt
krascancerpres.pptkrascancerpres.ppt
krascancerpres.ppt
 
Hormone therapy in breast cancer
Hormone therapy in breast cancerHormone therapy in breast cancer
Hormone therapy in breast cancer
 
Estrogen and breast cancer
Estrogen and breast cancerEstrogen and breast cancer
Estrogen and breast cancer
 
B0211117
B0211117B0211117
B0211117
 
Biochemistry of cancer
Biochemistry of cancerBiochemistry of cancer
Biochemistry of cancer
 
Biochemistry of cancer ,An overview
Biochemistry of cancer ,An overviewBiochemistry of cancer ,An overview
Biochemistry of cancer ,An overview
 
Molecular basis of head and neck cancer
Molecular basis of head and neck cancerMolecular basis of head and neck cancer
Molecular basis of head and neck cancer
 
Anindya seminar 1 growth factors and cell cycle signalling in pathogenesis of...
Anindya seminar 1 growth factors and cell cycle signalling in pathogenesis of...Anindya seminar 1 growth factors and cell cycle signalling in pathogenesis of...
Anindya seminar 1 growth factors and cell cycle signalling in pathogenesis of...
 
Cancer biology
Cancer biologyCancer biology
Cancer biology
 
Lepow Day Poster 2
Lepow Day Poster 2Lepow Day Poster 2
Lepow Day Poster 2
 
Cancer Genetics - Denise Sheer
Cancer Genetics - Denise SheerCancer Genetics - Denise Sheer
Cancer Genetics - Denise Sheer
 
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
 
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
Adenomatous polyposis coli (apc) gene mutation in a population of prostate ca...
 
Medical Students 2011 - N. Pavlidis - BREAST CANCER SESSION - Systemic Treatm...
Medical Students 2011 - N. Pavlidis - BREAST CANCER SESSION - Systemic Treatm...Medical Students 2011 - N. Pavlidis - BREAST CANCER SESSION - Systemic Treatm...
Medical Students 2011 - N. Pavlidis - BREAST CANCER SESSION - Systemic Treatm...
 
Anti Cancer Drugs.pptx
Anti Cancer Drugs.pptxAnti Cancer Drugs.pptx
Anti Cancer Drugs.pptx
 
Tumor suppressor gene
Tumor suppressor gene Tumor suppressor gene
Tumor suppressor gene
 

Recently uploaded

Hubble Asteroid Hunter III. Physical properties of newly found asteroids
Hubble Asteroid Hunter III. Physical properties of newly found asteroidsHubble Asteroid Hunter III. Physical properties of newly found asteroids
Hubble Asteroid Hunter III. Physical properties of newly found asteroidsSérgio Sacani
 
Nanoparticles synthesis and characterization​ ​
Nanoparticles synthesis and characterization​  ​Nanoparticles synthesis and characterization​  ​
Nanoparticles synthesis and characterization​ ​kaibalyasahoo82800
 
Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )aarthirajkumar25
 
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service  🪡CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service  🪡
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡anilsa9823
 
Zoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdfZoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdfSumit Kumar yadav
 
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.Nitya salvi
 
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls AgencyHire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls AgencySheetal Arora
 
Formation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksFormation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksSérgio Sacani
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsAArockiyaNisha
 
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43bNightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43bSérgio Sacani
 
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRStunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRDelhi Call girls
 
Isotopic evidence of long-lived volcanism on Io
Isotopic evidence of long-lived volcanism on IoIsotopic evidence of long-lived volcanism on Io
Isotopic evidence of long-lived volcanism on IoSérgio Sacani
 
Green chemistry and Sustainable development.pptx
Green chemistry  and Sustainable development.pptxGreen chemistry  and Sustainable development.pptx
Green chemistry and Sustainable development.pptxRajatChauhan518211
 
VIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C PVIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C PPRINCE C P
 
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...Sérgio Sacani
 
Chromatin Structure | EUCHROMATIN | HETEROCHROMATIN
Chromatin Structure | EUCHROMATIN | HETEROCHROMATINChromatin Structure | EUCHROMATIN | HETEROCHROMATIN
Chromatin Structure | EUCHROMATIN | HETEROCHROMATINsankalpkumarsahoo174
 
Pests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdfPests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdfPirithiRaju
 
Animal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxAnimal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxUmerFayaz5
 
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...Sérgio Sacani
 

Recently uploaded (20)

Hubble Asteroid Hunter III. Physical properties of newly found asteroids
Hubble Asteroid Hunter III. Physical properties of newly found asteroidsHubble Asteroid Hunter III. Physical properties of newly found asteroids
Hubble Asteroid Hunter III. Physical properties of newly found asteroids
 
Nanoparticles synthesis and characterization​ ​
Nanoparticles synthesis and characterization​  ​Nanoparticles synthesis and characterization​  ​
Nanoparticles synthesis and characterization​ ​
 
Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )
 
The Philosophy of Science
The Philosophy of ScienceThe Philosophy of Science
The Philosophy of Science
 
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service  🪡CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service  🪡
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡
 
Zoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdfZoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdf
 
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
❤Jammu Kashmir Call Girls 8617697112 Personal Whatsapp Number 💦✅.
 
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls AgencyHire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
 
Formation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksFormation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disks
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based Nanomaterials
 
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43bNightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
Nightside clouds and disequilibrium chemistry on the hot Jupiter WASP-43b
 
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRStunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
 
Isotopic evidence of long-lived volcanism on Io
Isotopic evidence of long-lived volcanism on IoIsotopic evidence of long-lived volcanism on Io
Isotopic evidence of long-lived volcanism on Io
 
Green chemistry and Sustainable development.pptx
Green chemistry  and Sustainable development.pptxGreen chemistry  and Sustainable development.pptx
Green chemistry and Sustainable development.pptx
 
VIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C PVIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C P
 
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
 
Chromatin Structure | EUCHROMATIN | HETEROCHROMATIN
Chromatin Structure | EUCHROMATIN | HETEROCHROMATINChromatin Structure | EUCHROMATIN | HETEROCHROMATIN
Chromatin Structure | EUCHROMATIN | HETEROCHROMATIN
 
Pests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdfPests of mustard_Identification_Management_Dr.UPR.pdf
Pests of mustard_Identification_Management_Dr.UPR.pdf
 
Animal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxAnimal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptx
 
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
 

GSTM1 Gene Polymorphism in Sporadic Breast Cancer Patients

  • 1. GSTM1 gene Polymorphism in Sporadic Breast Cancer Patients Sateesh Chandra Gupta
  • 2. Overview  Cancer  Breast cancer  sporadic ,familial and hereditary breast cancer  Types of Breast Cancer  Stages of Breast cancer  causes of breast cancer  Genetic, Environmental, Life style and hormonal factor  Polymorphism  Classes of polymorphism  Role of polymorphism in breast cancer  glutathione S-transferase (GST)  Glutathione S-transferase Mu1 ( GST M1)  Work Flow  Result  Reference
  • 4. Cancer  Cancer is a group of more than 100 disease that developed across time and involved the uncontrolled cell division of body.  Cancer are arise from the loss of normal growth control.  In normal tissue, the rate of new cell growth and old cell death are balance with the process known as cell division and apoptosis respectively.  In cancerous cell this balance is disrupted.
  • 5. Breast cancer  Breast cancer is the most common type of cancer (29%) among women in the world  An estimated 40,730 breast cancer deaths (40,290 women, 440 men) are expected in 2015. Breast cancer ranks second as a cause of cancer death in women (after lung cancer).  The risk of breast cancer increases with age and most breast cancers occur after the age of 50. (America Cancer Society, 2015 )  Breast Cancer is a malignant tumor that start in the cells of breast.  A malignant tumor is a group of cancer cells that can grow(invade) into surrounding tissue or spread (metastasize) nearby area of the body.
  • 6. Breast Cancer The disease occur almost entirely in the women but men also get it.  Most commonly from inner lining of milk duct or lobules that supply ducts with milk.  Cancer originating from duct are known as ductal carcinoma, while those originating from lobules are known as lobular carcinoma.
  • 7. Hereditary Breast cancer Sporadic Familial  Approximate 10%  Clustering within family.  Not hereditary  Early onset than sporadic cancer.  Risk factor - same life style of a family.  Approximate 85 %  Late onset  Risk factor –age exposure to environmental carcinogens, Hormone and Lifestyle .  Approximate 5-7 %.  Same type of cancer in the family.  Early onset.  Bilateral.  Having strong family history.  results from same genetic and environment or lifestyle factors.
  • 8. Breast carcinoma Invasive Breast CarcinomaNon-invasive Breast Carcinoma Ductal Carcinoma. Lobular Carcinoma. Invasive Ductal Carcinoma Invasive Lobular Carcinoma Inflammatory Carcinoma Secretary Carcinoma Tubular Carcinoma
  • 9. Receptor specific Breast cancer Receptor Hormone Receptor (HR) Tyrosine Kinase Receptor Estrogen Receptor(ER) Progesterone Receptor(PR) HER2 Receptor ER Positive ER Negative PR Positive PR Negative HER2 Positive HER2 Negative Triple Negative Breast Cancer are Estrogen Receptor(ER), Progesterone Receptor(PR) and Human Epidermal Growth Receptor 2(HER2) negative ,Hence called as triple negative breast cancer
  • 11. GENETIC  The genome is susceptible to damage by both intrinsic( like Cell division errors) and extrinsic factors(carcinogens and radiations) .  Certain genes called Tumor Suppressor genes (BRCA1, BRCA2, TP53, ATM and PTEN) are involved in maintenance of genomic stability.  Mutations that impair their function predisposes an individual to develop cancer.  Accumulation of mutations causing DNA damage transforms a normal cell to a cancerous cell. ( Emel Ergul Ali Sajki et al. 2000 )
  • 12. EnvironmentalFactor  Natural or synthetic substances in environment that can cause cancer are called environmental carcinogens.  Divided into  Chemical agents - Lead, cobalt, asbestos, nitrosamine and many type of pesticide.  Physical agents – X- rays, Gamma rays and Ultraviolet rays  Light at Night (LAN Hypothesis) May decrease the synthesis of melatonin- change in melatonin may affect the level of estrogen and initiate the breast cancer. (Richard G Stevens 2009)
  • 13. LIFE STYLE SMOKING and ALCOHOL DRINKING  Each cigarette contains a mixture of carcinogens including polycyclic aromatic hydrocarbons (PAHs), N-nitrosamines, NO2 and free radicals .  Cytochrome P-450 enzymes (P-450s) convert the carcinogens to more reactive forms which bind to DNA and form DNA adduct.  Alcohol in the body converts into the aldehyde. Acetaldehyde converts into the Reactive Oxygen Species (ROS),which react with DNA to form DNA adducts, which may initiate cancer.  Alcoholic beverage consumption in women also causes an increase in levels of endogenous estrogens hormone.
  • 14. Smoke & alcohol carcinogens in cancer.. Metabolic Activation Metabolic Detoxification Repair Excretion Normal DNA Uptake of Smoke & Alcohol Carcinogen DNA Adduct Mutation in DNA repair genes and Tumor - suppresso r genes Loss of normal growth control mechanis m Cancer
  • 15. HORMONAL  Estrogens and progesterone are essential hormone for normal breast development. The main estrogens are estradiol and estrone, as well as 16-hydroxyestradiol (estriol). Estrone and estradiol hydroxylated at positions C2, C4 and C16 (2 hydroxyestrone, 4 hydroxyestrone 2-hydroxyestradiol, and 4- hydroxyestradiol), and 16a- hydroxyestrone. carcinogenic potential by damaging DNA
  • 16. Estrogen Catabolism... COMT GST CYP450 CYP450 DNA CYP450 1A2 CYP450 1B1 CYP450 CYP450 DNA COMT GST 2-Methoxy Estrogens 2-Hydroxy estrogen Estrogen E,2,3 semi Q E,2,3 Q Glutathione Conjugate 4-Hydroxy estrogen E,4,3 semi Q E,4,3 Q DNA Adduct Glutathione Conjugate4-Methoxy estrogen CANCER DNA Adduct
  • 17. Premenopausal Postmenopausal Estrogen Ovaries adipose tissue, muscle liver ER ER Breast Cancer Ovarian removal Aromatase Inhibitors Tamoxifen Tamoxifen Receptor Mediated Carcinogenesis of Estrogen
  • 18. xP0LYMORPHISm  polymorphism is a DNA sequence variation that seen in more than 1% in normal population. In this case no single allele is regarded as the standard sequence. There are two or more acceptable alternatives. Classes of polymorphism  Single Nucleotide Polymorphisms (SNP): is a genetic variation when a single nucleotide (i.e., A, T, C, or G) is altered .  Variable Number of Tandem Repeats or VNTR: is a location on genome where a short nucleotide sequence organized as tandem repeat.  Microsatellites or STR or SSR: short tandem repeat (2 – 6 bp long)  Minisatellites : simple sequence repeats (10 – 40 bp long)
  • 19. Cont… Example of SNP Example of STR ATCGACTGCGATCATGCATGCATGCATGCATGC ATGCATGCATGCATGCATGCCTACGTGACTGAC Here sequence CATG are repeated several times. Ex. of Minisatellit CCATCACATATATTCCATATATTCACATATATTACCA GACTCACATATATTCACATATATTCACATATATTCTA Here sequence CACATATATT are repeated several times. C T T C A T C G A T C G G C T T C A T G G A T C G G
  • 20. Role of polymorphism in Development of breast cancer  Polymorphisms consist of minor changes in DNA sequence -modify the structure, expression or activity of the proteins.  Polymorphisms in xenobiotic or carcinogenic metabolic genes give rise to variable enzyme activity - differing abilities in the metabolism of xenobiotic or carcinogen.  When the activity of xenobiotic metabolizing enzyme is impaired by polymorphism it will not metabolize the Xenobiotic and carcinogenic compound.  xenobiotic or carcinogenic compounds react with DNA and form the DNA adduct - causes mutation and initiation of breast cancer.
  • 21. GlutathioneS-transferase(GST)  Glutathione S-Transferase (GSTs), is a phase ll xenobiotic detoxifying enzyme.  GSTs catalyses the conjugation of glutathione (GSH) to a wide variety of endogenous and exogenous electrophilic compounds . Alpha class Mu Class Pai Class Theta Class Zeta Class Omega Class Sigma Class GSTA1, GSTA2, GSTA3, GSTA4, GSTA5 GSTM1,GSTM2,GSTM3,GSTM4,GSTM5 GST P1 GSTT1, GST T2 GST Z1 GST O1, GST O2 GST S1 Cytosolic Mitochondrial Microsomal (MAPEG) GST Kappa Class MGST GST K1 MGST1, MGST2, MGST3
  • 22. Glutathione S –Transferase Mu 1 (GST M1)  Located on chromosome 1p13.3. Having 8 exons. Gene size is 5490 bp.  GSTM1 is polymorphically expressed, and three alleles have been identified:GSTM1*0,GSTM1a and GSTM1b.  The GSTM1a and GSTM1b are functionally identical, but differ by single nucleotide substitution C >G at base position 519 or position aa173 Lys convert in the asparagine.  Homologous deletion results in the loss of this gene thus loss of function of the enzyme.
  • 23. Blood sample collection DNA Extraction By Phenol -Chloroform Method Genotyping By Multiplex PCR Sample loading on 1% agarose gel Work Flow Lymphocytes Separation Blood sample collection Lymphocytes Separation
  • 24. Multiplex PCR- Amplification of many desired DNA fragments.  We used two sets of primers: IFN gene primer pairs and GSTM1 primer pairs. IFN primers were used to detect that whether PCR has worked or not. Condition for PCR Initial Denaturation Temperature 95 0c For 5 Minutes Denaturation Temperature 950c for 45 second Annealing Temperature 600c for 45 second Extension temperature 720c for 45 second Final extension temperature 720c 5 minutes 34 cycles
  • 25. Master Mix for PCR Component 1X(for One Reaction) nX (for n reaction) MilliQ water 12.4µl 12.4n µl 10X PCR Buffer (Axygen) 2.5µl 2.5n µl 25mM dNTP 1.0µl 1.0n µl 10pmol IFN (forward Primer) 5′ GGCACAACAGGTAGTAGGCG 3′ 1.0µl 1.0n µl 10pmol IFN (Reverse Primer) 5′ GCCACAGGACGTACTGACAC 3 1.0µl 1.0n µl 10pmol GSTM1 (Forward Primer) 5′CTGGATAGTAGCAGATCATGC 3′ 1.0µl 1.0n µl 10pmol GSTM1 (Reverse Primer) 5′ CTGCCCTACTTGATTGATGGG 3′ 1.0µl 1.0n µl Sample DNA (20ng/µl) 5.0µl 5.0n µl Taq. Polymerase (10U/µl) 0.1µl 0.1n µl
  • 26. 100 bp Ladder- 1 Result Rrrrr Wild Type Wells- 3, 5 1 2 3 4 5 Null Type Wells-2, 4 GST M1 (273 bp)IFN (173 bp) 500 bp 1 Result 100 bp Ladder Well -1
  • 27. Frequency of GST M1 Homozygous Null Genotypes in worldwide Populations Frequency of GST M1 Homozygous Null Genotypes in ACTREC Cohort Resultcontd.... GST M1 Joanne E. Curran et al. Australia (2000) Christine B. Ambrosone et al. New York ( 1995) Samson et al.(2007) South India Genotype Null Type Wild Type Null Type Wild Type Null Type Wild Type SC 56 (43% ) 73 (57% ) 84(48%) 93 (52%) 65(28.3%) 185(71.7%) SN 57 (44% ) 72 (56% ) 116(50%) 117(50%) 110(22%) 390(78%) Genotype Case (SC) 180 Control (SN) 188 Odds Ratio 95% CI P Value Null 68(37.7%) 60(37.3%) 1.0235 0.6710 – 1.5611 P =0.9142Wild 112(62.3%) 118(62.7%) All the Analytical analysis are calculated by using online software www.medcalc.net
  • 28.  Correlation of different variable in development of breast cancer in case and control. Association between Breast Cancer Risk and Food Preference among Case and Control population: Vegetarian OR P Value Non Vegetarian OR P Value Case Control 1.117 95% CI 0.506 – 2.457 P=0.784 Case Control 0.936 95% CI 0.556 – 1.576 0.803 Null 17 26 45 42 Wild 24 41 87 76 There are no Statistical significance have been found ( OR =1.117, P =0.784 and OR =0.936, P = 0.803) between Breast cancer case and healthy control population in ,correlation with food preference Vegetarian and non Vegetarian Respectively.
  • 29.  Association between Breast Cancer Risk and Tobacco consumption Among Case and Control Tobacco User OR P Value Non User OR P Value Case Control 0.7955 95% CI 0.2362 - 2.6788 P=0.711 1 case Control 0.9951 95% CI 0.5976– 1.6570 P=0.985 0 Null 7 11 51 41 Wild 12 15 95 76 There are no Statistical significance have been found ( OR =0.7955, P =0.7111and OR =09951, P = 0.9850) between Breast cancer case and healthy control population in ,correlation with Tobacco consumption, tobacco user and non user Respectively.
  • 30.  Association between Breast Cancer Risk and Menopause status among Case and Control Premenopause OR P Value Postmenopause OR P Value Case Control 0.997 95% CI 0.556 – 1.789 P=0.993 Case Control 0.927 95% CI 0.488 – 1.759 P=0.817 Null 33 39 29 29 Wild 56 66 55 51 There are no Statistical significance have been found ( OR =0.997, P =0.993 and OR =0.927, P = 0.817) between Breast cancer case and healthy control population in ,correlation with Menopause status,premenopause and Postmenopause Respectively.
  • 31. conclusion  The frequency of null polymorphism in breast cancer patients and healthy individual is almost similar (37%) null and wild genotype frequency (63%).  Our finding are in coherence with the previously studies worldwide.  The present study suggest that ,the null polymorphism in GSTM1 may not be involved in sporadic breast cancer susceptibility, But have the modifier effect in initiation of breast cancer in combination with other detoxifying enzyme, like GSTT1, GSTP1,CYP450,NAT and COMT.
  • 32. Conclusion cont..  We also correlate breast cancer case and healthy control with many variable ,like food preference, Tobacco consumption and menopause status, but there are no statistical significant value have been found.  Further, we need to extend our study in a larger cohort to stabilise the precise role of null polymorphism in GSTM1 in sporadic breast cancer susceptibility.
  • 33. Reference  Christine B. Ambrosone, Cytochrome P4501A1 and Glutathione S-Transferase (M1) Genetic Polymorphisms and Postmenopausal Breast Cancer Risk.  A Khedhaier, Glutathione S-transferases (GSTT1 and GSTM1) gene deletions inTunisians: susceptibility and prognostic implications in breast carcinoma.  Joanne E. Curran, Polymorphisms of glutathione S-transferase genes(GSTM1, GSTP1 and GSTT1) and breast cancer susceptibility  Hamed Samavat, Estrogen metabolism and breast cancer.  Stephen S. Hecht, Tobacco smoke carcinogens and breast cancer.  Ramona G. Dumitrescu, The etiology of alcohol-induced breast cancer  Alison M. Dunning, A Systematic Review Of Genetic Polymorphisms and Breast Cancer Risk  S.Zhong, Relationship between the GSTM1 genetic polymorphism and susceptibility to bladder, breast and colon cancer