Sickle cell anemia is a disease where red blood cells take on an abnormal sickle shape. This is caused by a defective hemoglobin protein within the red blood cells. When the defective hemoglobin called HbS is without oxygen bound to it, it forms precipitates that cause the cells to sickle. A person's genes determine if they have sickle cell anemia - having two normal genes prevents the disease, while having two sickle cell genes causes a severe case. Treatments include blood transfusions, antibiotics, hydroxyurea, and potentially a bone marrow transplant in severe cases.

1. Created by:
Mr. Ankitkumar Upadhyaya
(M.sc Bioinformatics)

2. Overview of
Sicke-Cell Anemia
Sickle cell anemia is a disease in which the patient's red blood cells have an abnormal shape much like that
of a sickle.
The abnormal shape of the cells in individuals with sickle cell anemia comes from a defective protein
within the blood cells themselves.
This defective protein is hemoglobin. The normal hemoglobin protein is made up of four parts, and
therefore called a tetramer.
Each part of the tetramer has the ability to bind an oxygen molecule and carry it from the lungs to the
tissues in which oxygen is needed.
When the defective hemoglobin in sickle cell anemia, referred to as Hb S, does not have an oxygen
molecule bound, it tends to form a precipitate made up of lots of hemoglobin proteins stuck to each other.
This precipitate is what causes the red blood cells to become sickle-shaped.

3. Which gene responsible???
HBB: The Gene Associated
with Sickle Cell Anemia.
Official Gene Symbol: HBB
Name of Gene Product:
hemoglobin, beta
Alternate Name of Gene
Product: beta globin
Locus: 11p15.5 - The HBB
gene is found in region 15.5
on the short (p) arm of
human chromosome 11.

4. Sickle cell
anemia
Sickle cell anemia is a disease in which the patient's red blood cells have an abnormal shape
much like that of a sickle.
The abnormal shape of the cells in individuals with sickle cell anemia comes from a defective
protein within the blood cells themselves. This defective protein is hemoglobin. The normal
hemoglobin protein is made up of four parts, and therefore called a tetramer. Each part of the
tetramer has the ability to bind an oxygen molecule and carry it from the lungs to the tissues
in which oxygen is needed. When the defective hemoglobin in sickle cell anemia, referred to
as Hb S, does not have an oxygen molecule bound, it tends to form a precipitate made up of
lots of hemoglobin proteins stuck to each other. This precipitate is what causes the red blood
cells to become sickle-shaped

5. Mutation in the sequence
Find the position
Step:
1) Open the http://workbench.sdsc.edu
2) End of the page click “protein tool”
3) Select the Ndjinn-multiple database search
4) Click run button & select the pdbfinder option & type the hemoglobin & click on
search button .
5) There are display the 455 structure .find (select)the normal hemoglobin structure
(1hab)as well as sickle cell hemoglobin structure(2hbs) .
6) Click on “show record” & select the beta chain of the both record.
7) select the clustalw tool & import the both sequences.
8) Change the parameter which you want ..
9) Click on run button

8. Whether a person has sickle cell anemia or not is determined by the person's genes. The DNA
sequences you looked at for the normal and sickle cell hemoglobin are two versions of the gene for
hemoglobin. However, it's not as simple as saying that if a person has the sickle cell hemoglobin gene,
then they have the disease.
Since each person has two sets of genes, one from the mother and one from the father, there are two
copies of the gene for hemoglobin. This is important because a person can have two of the sickle cell
anemia gene, or a normal and a disease gene, or two normal genes. Each of these combinations results
in a different situation for the person. If a person has two of the same genes, either two normal or two
sickle cell genes, they are "homozygous" (homo=the same). If a person has two different genes for
hemoglobin, then they are called "heterozygous" (hetero=different).
A person who is heterozygous for the hemoglobin gene will have a few sickle-shaped red blood cells,
and a very mild case of sickle cell anemia. Meanwhile, a person who is homozygous for the sickle cell
hemoglobin will have lots of sickled cells and have a full-blown case of the disease. A person who is
homozygous for normal hemoglobin will have completely normal red blood cells

9. Anemia. Sickle cells are fragile. They break apart easily and die, leaving you chronically short on red
blood cells. Red blood cells usually live for about 120 days before they die and need to be replaced.
However, sickle cells die after only 10 to 20 days. The result is a chronic shortage of red blood cells,
known as anemia. Without enough red blood cells in circulation, your body can't get the oxygen it
needs to feel energized. That's why anemia causes fatigue.
Episodes of pain. Periodic episodes of pain, called crises, are a major symptom of sickle cell anemia.
Pain develops when sickle-shaped red blood cells block blood flow through tiny blood vessels to your
chest, abdomen and joints. Pain can also occur in your bones. The pain may vary in intensity and can
last for a few hours to a few weeks. Some people experience only a few episodes of pain. Others
experience a dozen or more crises a year. If a crisis is severe enough, you may need hospitalization so
that pain medication can be injected into your veins (intravenously).
Hand-foot syndrome. Swollen hands and feet may be the first signs of sickle cell anemia in babies.
The swelling is caused by sickle-shaped red blood cells blocking blood flow out of their hands and
feet.

10. Jaundice. Jaundice is a yellowing of the skin and eyes that occurs because of liver damage or dysfunction.
Occasionally, people who have sickle cell anemia have some degree of jaundice because the liver, which
filters harmful substances from the blood, is overwhelmed by the rapid breakdown of red blood cells. In
people with dark skin, jaundice is visible mostly as yellowing of the whites of the eyes.
Frequent infections. Sickle cells can damage your spleen, an organ that fights infection. This may make you
more vulnerable to infections. Doctors commonly give infants and children with sickle cell anemia
antibiotics to prevent potentially life-threatening infections, such as pneumonia.
Delayed growth. Red blood cells provide your body with the oxygen and nutrients you need for growth. A
shortage of healthy red blood cells can slow growth in infants and children and delay puberty in teenagers.
Vision problems. Some people with sickle cell anemia experience vision problems. Tiny blood vessels that
supply your eyes may become plugged with sickle cells. This can damage the retina — the portion of the eye
that processes visual images.
When to see a doctor
Although sickle cell anemia is usually diagnosed in infancy, if you or your child develops any of the
following problems, see your doctor right away or seek emergency medical care.
Any signs or symptoms of stroke. If you notice any one-sided paralysis or weakness in the face, arms or
legs, confusion, trouble walking or talking, sudden vision problems .

11. Stroke. A stroke can occur if sickle cells block blood flow to an area of your brain. Stroke is one of the most
serious complications of sickle cell anemia. Signs of stroke include seizures, weakness or numbness of your
arms and legs, sudden speech difficulties, and loss of consciousness. If your baby or child has any of these
signs and symptoms, seek medical treatment immediately. A stroke can be fatal.
Acute chest syndrome. This life-threatening complication of sickle cell anemia causes chest pain, fever and
difficulty breathing. Acute chest syndrome can be caused by a lung infection or by sickle cells blocking
blood vessels in your lungs. It requires emergency medical treatment with antibiotics, blood transfusions
and drugs that open up airways in your lungs. Recurrent attacks can damage your lungs.
Pulmonary hypertension. About one-third of people with sickle cell anemia will eventually develop high
blood pressure in their lungs (pulmonary hypertension). Shortness of breath and difficulty breathing are
common symptoms of this condition, which can ultimately lead to heart failure.
Organ damage. Sickle cells can block blood flow through blood vessels, immediately depriving an organ of
blood and oxygen. In sickle cell anemia, blood is also chronically low on oxygen. Chronic deprivation of
oxygen-rich blood can damage nerves and organs in your body, including your kidneys, liver and spleen.
Organ damage can be fatal.
Blindness. Tiny blood vessels that supply your eyes can get blocked by sickle cells. Over time, this can
damage the retina — the portion of the eye that processes visual images — and lead to blindness.
Skin ulcers. Sickle cell anemia can cause open sores, called ulcers, on your legs.
Gallstones. The breakdown of red blood cells produces a substance called bilirubin. Bilirubin is responsible
for yellowing of the skin and eyes (jaundice) in people with sickle cell anemia. A high level of bilirubin in
your body can also lead to gallstones.

12. Diagnosis &Treatment
Blood test - More than 40 states
now perform a simple,
inexpensive blood test for sickle
cell disease on all newborn
infants. This test is performed at Treatment
the same time and from the same most important three
blood samples as other routine
newborn-screening tests.
method…..
Hemoglobin electrophoresis is • Blood Transfusions
the most widely used diagnostic
test. If the test shows the presence • Oral Antibiotics
of sickle hemoglobin, a second • Hydroxyurea
blood test is performed to
confirm the diagnosis. These tests
also tell whether or not the child
carries the sickle cell trait.

13. • Bone marrow is the flexible tissue found in the hollow interior of
bones. In adults, marrow in large bones produces new blood cells. It
constitutes 4% of the total body weight of humans.
• Type of the Bone Marrow:
1)Red Bone Marrow :
2)Yellow Bone Marrow :
Stroma:
• The stroma of the bone marrow is all tissue not directly involved in the
primary function of hematopoiesis. The yellow bone marrow
belongs here, and makes the majority of the bone marrow stroma, in
addition to stromal cells located in the red bone marrow. Yellow
bone marrow is found in the Medullary cavity

14. • If the family of a child with sickle cell disease is considering bone marrow
transplantation, it must first meet three requirements
The bone marrow donor must
a) be a sibling
b) be an immunologic match (HLA type match)
c) not have sickle cell disease.
Donation &Tranplantation:
• It is possible to take hematopoietic stem cells from one person and then
infuse them into another person (Allogenic) or into the same person at a
later time (Autologous).
• If donor and recipient are compatible, these infused cells will then travel to
the bone marrow and initiate blood cell production.
• Transplantation from one person to another is performed in severe cases of
disease of the bone marrow

15. Continue……
• The patient's marrow is
first killed off with
drugs or radiation, and
then the new stem cells
are introduced
• Before radiation therapy
or chemotherapy in
cases of cancer, some of
the patient's
hematopoietic stem cells
are sometimes harvested
and later infused back
when the therapy is
finished to restore the
immune system

16. • procedure is risky: Between 5 and 10 percent of children who undergo the
process don't survive because of a major infection, uncontrollable bleeding, or
organ failure involving the liver, kidney, lungs.
• Another 8 to 12 percent reject the graft (the term used to describe the
transplanted bone marrow).
• These dangers restrict bone marrow transplants to children in relatively good
physical condition and who suffer such serious complications from sickle cell
disease that their families feel the risks are worth taking
• Siblings hold the key:
• A full HLA (or immunologic) match between brothers or sisters offer the best
chances for a successful bone marrow transplant (BMT).
• two negative side effects:
1) Graft rejection: in which your child goes through the transplantation
process, only to have her own bone marrow grow back.
2) Graft vs. Host Disease, in which the transplanted marrow perceives the rest of your
child's body as foreign tissue and attacks it. This condition can be mild and treated with a brief
course of immune-suppressant medications, or it can be quite severe and cause life-
threatening damage to the body. Occasionally, it can be a chronic problem and require long-
term treatment

17. • This procedure replaces bone marrow affected by sickle cell anemia
with healthy bone marrow from a donor who doesn't have the disease.
• It can be a cure, but the procedure is risky, and it's difficult to find
suitable donors.
• Researchers are still studying bone marrow transplants for people with
sickle cell anemia.
• Currently, the procedure is recommended only for people who have
significant symptoms and problems from sickle cell anemia.
• Bone marrow transplant requires a lengthy hospital stay. After the
transplant, you'll need drugs to help prevent rejection of the donated
marrow.

18. • Hydroxyurea is an anti-cancer ("antineoplastic" or "cytotoxic")
chemotherapy drug. Hydroxyurea is classified as an
"antimetabolite."
• HbF, also called fetal hemoglobin, is the form of hemoglobin present
in the fetus and small infants.
• Most HbF disappears early in childhood, although some HbF may
persist. Fetal hemoglobin is able to block the sickling action of red
blood cells. Because of this, infants with sickle cell disease do not
develop symptoms of the illness until.
• HbF levels have dropped. Adults who have sickle cell disease but
still retain high levels of hemoglobin F generally have mild disease
• Hydroxyurea (Droxia) is a drug that reduces the severity of sickle
cell disease by stimulating production of HbF. It is currently the
only drug in general use to prevent acute sickle cell crises

19. • One mechanism of action is believed to be based on its reduction
of production of deoxyribonucleotides[1] via inhibition of the
enzyme ribonucleotide reductase by scavenging tyrosyl free
radicals as they are involved in the reduction NDPs.[2]
• In the treatment of sickle-cell disease, hydroxycarbamide increases
the concentration of fetal haemoglobin.
• The precise mechanism of action is not yet clear, but it appears that
hydroxycarbamide increases nitric oxide levels, causing soluble
guanylyl cyclase activation with a resultant rise in cyclic GMP, and
the activation of gammaglobulin synthesis necessary for fetal
hemoglobin (by removing the rapidly dividing cells that
preferentially produce sickle hemoglobin).[2][3]

20. • This prescription drug, normally used to treat cancer, may be
helpful for adults with severe disease.
• When taken daily, it reduces the frequency of painful crises and
may reduce the need for blood transfusions.
• It seems to work by stimulating production of fetal hemoglobin — a
type of hemoglobin found in newborns that helps prevent the
formation of sickle cells.
• There is some concern about the possibility that long-term use of
this drug may cause tumors or leukemia in certain people.
• Your doctor can help you determine if this drug may be beneficial
for you

21. • These side effects are less common side effects (occurring in about
10-29%) of patients receiving Hydroxyurea:
• Hair loss (mild thinning)
• Nausea and vomiting
• Diarrhea
• Mouth sores
• Poor appetite
• Nail thickening, nail banding (see skin reactions)
• Discoloration of the skin or nails (see skin reactions)
• Darkening of the skin where previous radiation treatment has been
given. (radiation recall - see skin reactions

22. •
Gene therapy. Because sickle cell anemia is caused by a defective gene,
researchers are exploring whether inserting a normal gene into the bone
marrow of people with sickle cell anemia will result in the production of
normal hemoglobin. Scientists are also exploring the possibility of turning off
the defective gene while reactivating another gene responsible for the
production of fetal hemoglobin — a type of hemoglobin found in newborns
that prevents sickle cells from forming.
• Butyric acid. Normally used as a food additive, butyric acid may increase the
amount of fetal hemoglobin in the blood.
• Clotrimazole. This over-the-counter antifungal medication helps prevent a
loss of water from red blood cells, which may reduce the number of sickle
cells that form.
• Nitric oxide. Sickle cell anemia causes low levels of nitric oxide, a gas that
helps keep blood vessels open and reduces the stickiness of red blood cells.
Treatment with nitric oxide may prevent sickle cells from clumping together.
• Nicosan. This is an herbal treatment in early trials in the U.S. Nicosan has
been used to prevent sickle crises in Nigeria

23. Develop a simple inexpensive DNA
test for sickle cell allele
• develop DNA probe
• test for presence of sickle cell mutation
• use bioinformatics tools
• online databases of DNA sequences
• UCSC Genome Browser
• probe design tool
• Primer3

24.  DNA double helix
 A–T, C–G
 base pair bonds can be broken
by heating to 100°C
 separate strands
 denature, or melt
2004-2005

25.  Probe
 short, single stranded DNA molecule
 mix with denatured DNA
 DNA Hybridization
 probe bonds to complementary DNA sequence
 Label
 probe is labeled for easy detection
labeled probe
G A T C A G T A G
genomic DNA
C T A G T C A T C
3’ 2004-2005
5’

26.  Allele specific probes
 probes require matched sequences
 can detect single base differences in alleles
 single mis-matched base near middle of probe
greatly reduces hybridization efficiency
labeled probe
genomic DNA
X
C T A G T C A T C
3’ 2004-2005 5’

27.  Genomic DNA
 denature DNA
 bind DNA from cells on filter paper
 DNA hybridization
 wash probe over filter paper
 if complementary sequence present, probe
binds to genomic DNA
 expose on X-ray film
 dark spots show bound probe

28.  UCSC Genome Browser
 human genome database
 http://genome.ucsc.edu/
 UCSC Genome Browser home page
 click on link to Genome Browser
 in genome pulldown menu, choose “Human”
 for position text box, type “HBB” (hemoglobin  )
 hit “submit”
2004-2005

29.  Listing of genes & sequences in database
 Click on “RefSeq” gene for HBB (NM_000518)

30.  Position of HBB in genome
 at base 5.2 million on chromosome 11

31.  Move & zoom tools
 zoom out ~30x to see more of chromosome 11

32.  Cluster of hemoglobin genes on
chromosome 11
 HBD, HBG1, HBG2 & HBE1
 what are these genes?
2004-2005

33.  Click on the HBB RefSeq gene
 HBB RefSeq summary page

34.  Click on “Genomic Sequence from
assembly”

35.  Sequence Formatting Options
 “exons in upper case, everything else in lower
case”
 hit “submit”
 Genomic DNA
 lower case = introns
 spliced out of mRNA before translation
 upper case = exons
 translated into polypeptide chain

36. >hg16_refGene_NM_000518 range=chr11:5211005-5212610 5'pad=0 3'pad=0 revComp=TRUE
ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC
ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG
CAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGgttggtat
caaggttacaagacaggtttaaggagaccaatagaaactgggcatgtgga  first 50 bases are
gacagagaagactcttgggtttctgataggcactgactctctctgcctat
tggtctattttcccacccttagGCTGCTGGTGGTCTACCCTTGGACCCAG
untranslated “leader”
AGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGG sequence
CAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTG
ATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGT  actual protein coding
GAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGgtgag sequence starts at base
tctatgggacgcttgatgttttctttccccttcttttctatggttaagtt
catgtcataggaaggggataagtaacagggtacagtttagaatgggaaac
51
agacgaatgattgcatcagtgtggaagtctcaggatcgttttagtttctt  starting with
ttatttgctgttcataacaattgttttcttttgtttaattcttgctttct
ttttttttcttctccgcaatttttactattatacttaatgccttaacatt
letters ATG
gtgtataacaaaaggaaatatctctgagatacattaagtaacttaaaaaa
aaactttacacagtctgcctagtacattactatttggaatatatgtgtgc
ttatttgcatattcataatctccctactttattttcttttatttttaatt
gatacataatcattatacatatttatgggttaaagtgtaatgttttaata
tgtgtacacatattgaccaaatcagggtaattttgcatttgtaattttaa
aaaatgctttcttcttttaatatacttttttgtttatcttatttctaata
ctttccctaatctctttctttcagggcaataatgatacaatgtatcatgc
ctctttgcaccattctaaagaataacagtgataatttctgggttaaggca
2004-2005
atagcaatatctctgcatataaatatttctgcatataaattgtaactgat

37.  Sickle cell mutation
 single base mutation
 6th amino acid: glutamic acid  valine
 need DNA sequence to design probe
 SNPs
 single nucleotide polymorphisms
 “variations and repeats” section: pack
2004-2005

38.  several SNPs of HBB gene
 need mutation in exon
 near beginning of HBB protein
 rs334 = Hb S mutation

39.  “Sequence in Assembly” = normal sequence
 “Alternate Sequence” = sickle cell sequence
2004-2005

40.  Line up sequences
Normal: catggtgcacctgactcctgAggagaagtctgccgttactg
HBB: ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG
Mutant: catggtgcacctgactcctgTggagaagtctgccgttactg
 sequence fragment is enough to design DNA
probes for normal & mutant sequences

41.  Primer3
 free on Web from MIT
http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi
 powerful tool for primer design
 paste in sequence fragment
2004-2005

42.  Need 2 probes
 normal allele probe
 sickle cell allele probe
 choose hybridization probes
 Customize probes
 12-16 bases
 40°-60°C
longer probes are stable at
higher temperatures 2004-2005

43.  Ready to order!
 Place an order at your local DNA lab!