Course "Machine Learning and Data Mining" for the degree of Computer Engineering at the Politecnico di Milano. In this lecture we discuss the data exploration and preparation.
Machine Learning and Data Mining: 15 Data Exploration and Preparation
1. Data Exploration and Preparation
Machine Learning and Data Mining (Unit 15)
Prof. Pier Luca Lanzi
2. References 2
Jiawei Han and Micheline Kamber, "Data Mining, : Concepts
and Techniques", The Morgan Kaufmann Series in Data
Management Systems (Second Edition)
Tom M. Mitchell. “Machine Learning” McGraw Hill 1997
Pang-Ning Tan, Michael Steinbach, Vipin Kumar,
“Introduction to Data Mining”, Addison Wesley
Ian H. Witten, Eibe Frank. “Data Mining: Practical Machine
Learning Tools and Techniques with Java Implementations”
2nd Edition
Prof. Pier Luca Lanzi
3. Outline 3
Data Exploration
Types of data
Descriptive statistics
Visualization
Data Preprocessing
Aggregation
Sampling
Dimensionality Reduction
Feature creation
Discretization
Attribute Transformation
Compression
Concept hierarchies
Prof. Pier Luca Lanzi
4. Types of data sets 4
Record
Data Matrix
Document Data
Transaction Data
Graph
World Wide Web
Molecular Structures
Ordered
Spatial Data
Temporal Data
Sequential Data
Genetic Sequence Data
Prof. Pier Luca Lanzi
5. Important Characteristics of 5
Structured Data
Dimensionality
Curse of Dimensionality
Sparsity
Only presence counts
Resolution
Patterns depend on the scale
Prof. Pier Luca Lanzi
6. Record Data 6
Data that consists of a collection of records, each of which
consists of a fixed set of attributes
Tid Refund Marital Taxable
Income Cheat
Status
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10
Prof. Pier Luca Lanzi
7. Data Matrix 7
If data objects have the same fixed set of numeric attributes, then
the data objects can be thought of as points in a multi-dimensional
space, where each dimension represents a distinct attribute
Such data set can be represented by an m by n matrix, where there
are m rows, one for each object, and n columns, one for each
attribute
Projection Projection Distance Load Thickness
of x Load of y load
10.23 5.27 15.22 2.7 1.2
12.65 6.25 16.22 2.2 1.1
Prof. Pier Luca Lanzi
8. Document Data 8
Each document becomes a `term' vector,
each term is a component (attribute) of the vector,
the value of each component is the number of times the
corresponding term occurs in the document.
timeout
season
coach
game
score
team
ball
lost
play
win
Document 1 3 0 5 0 2 6 0 2 0 2
Document 2 0 7 0 2 1 0 0 3 0 0
Document 3 0 1 0 0 1 2 2 0 3 0
Prof. Pier Luca Lanzi
9. Transaction Data 9
A special type of record data, where
each record (transaction) involves a set of items.
For example, consider a grocery store. The set of
products purchased by a customer during one shopping
trip constitute a transaction, while the individual products
that were purchased are the items.
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
Prof. Pier Luca Lanzi
10. Graph Data 10
Generic graph and HTML Links
<a href="papers/papers.html#bbbb">
Data Mining </a>
<li>
2 <a href="papers/papers.html#aaaa">
Graph Partitioning </a>
1
5 <li>
<a href="papers/papers.html#aaaa">
2 Parallel Solution of Sparse Linear
System of Equations </a>
5 <li>
<a href="papers/papers.html#ffff">
N-Body Computation and Dense Linear
System Solvers
Prof. Pier Luca Lanzi
11. Chemical Data 11
Benzene Molecule: C6H6
Prof. Pier Luca Lanzi
12. Ordered Data 12
Sequences of transactions
Items/Events
An element of
the sequence
Prof. Pier Luca Lanzi
13. Ordered Data 13
Genomic sequence data
GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG
Prof. Pier Luca Lanzi
14. Ordered Data 14
Spatio-Temporal Data
Average Monthly
Temperature of
land and ocean
Prof. Pier Luca Lanzi
15. What is data exploration? 15
A preliminary exploration of the data to better understand its
characteristics.
Key motivations of data exploration include
Helping to select the right tool for preprocessing or analysis
Making use of humans’ abilities to recognize patterns
People can recognize patterns not captured by data analysis
tools
Related to the area of Exploratory Data Analysis (EDA)
Created by statistician John Tukey
Seminal book is Exploratory Data Analysis by Tukey
A nice online introduction can be found in Chapter 1 of the NIST
Engineering Statistics Handbook
http://www.itl.nist.gov/div898/handbook/index.htm
Prof. Pier Luca Lanzi
16. Techniques Used In Data Exploration 16
In EDA, as originally defined by Tukey
The focus was on visualization
Clustering and anomaly detection were viewed
as exploratory techniques
In data mining, clustering and anomaly
detection are major areas of interest, and not
thought of as just exploratory
In our discussion of data exploration, we focus on
Summary statistics
Visualization
Online Analytical Processing (OLAP)
Prof. Pier Luca Lanzi
17. Iris Sample Data Set 17
Many of the exploratory data techniques are illustrated with the Iris
Plant data set http://www.ics.uci.edu/~mlearn/MLRepository.html
From the statistician Douglas Fisher
Three flower types (classes): Setosa, Virginica, Versicolour
Four (non-class) attributes, sepal width and length,
petal width and length
Virginica. Robert H. Mohlenbrock. USDA
NRCS. 1995. Northeast wetland flora: Field
office guide to plant species. Northeast National
Technical Center, Chester, PA. Courtesy of
USDA NRCS Wetland Science Institute.
Prof. Pier Luca Lanzi
18. Mining Data Descriptive Characteristics 18
Motivation
To better understand the data:
central tendency, variation and spread
Data dispersion characteristics
median, max, min, quantiles, outliers, variance, etc.
Numerical dimensions correspond to sorted intervals
Data dispersion: analyzed with multiple granularities of precision
Boxplot or quantile analysis on sorted intervals
Dispersion analysis on computed measures
Folding measures into numerical dimensions
Boxplot or quantile analysis on the transformed cube
Prof. Pier Luca Lanzi
19. Summary Statistics 19
They are numbers that summarize properties of the data
Summarized properties include frequency, location and
spread
Examples
Location, mean
Spread, standard deviation
Most summary statistics can be calculated in a single pass
through the data
Prof. Pier Luca Lanzi
20. Frequency and Mode 20
The frequency of an attribute value is the percentage of time
the value occurs in the data set
For example, given the attribute ‘gender’ and a
representative population of people, the gender ‘female’
occurs about 50% of the time.
The mode of a an attribute is the most frequent attribute
value
The notions of frequency and mode are typically used with
categorical data
Prof. Pier Luca Lanzi
21. Percentiles 21
For continuous data, the notion of a percentile is more useful
Given an ordinal or continuous attribute x and a number p
between 0 and 100, the pth percentile is a value xp of x such
that p% of the observed values of x are less than xp
For instance, the 50th percentile is the value x50% such that
x p
50% of all values of x are less than x50%
Prof. Pier Luca Lanzi
22. Measures of Location: Mean and Median 22
The mean is the most common measure of the location of a
set of points
However, the mean is very sensitive to outliers
Thus, the median or a trimmed mean is also commonly used
Prof. Pier Luca Lanzi
23. Measures of Spread: Range and Variance 23
Range is the difference between the max and min
The variance or standard deviation is the most common
measure of the spread of a set of points
However, this is also sensitive to outliers, so that other
measures are often used.
Prof. Pier Luca Lanzi
24. Visualization 24
Visualization is the conversion of data into a visual or tabular
format so that the characteristics of the data and the
relationships among data items or attributes can be analyzed
or reported
Visualization of data is one of the most powerful and
appealing techniques for data exploration
Humans have a well developed ability to analyze large
amounts of information that is presented visually
Can detect general patterns and trends
Can detect outliers and unusual patterns
Prof. Pier Luca Lanzi
25. Example: Sea Surface Temperature 25
The following shows the Sea Surface Temperature for July 1982
Tens of thousands of data points are summarized in a single figure
Prof. Pier Luca Lanzi
26. Representation 26
Is the mapping of information to a visual format
Data objects, their attributes, and the relationships among
data objects are translated into graphical elements such as
points, lines, shapes, and colors
Example:
Objects are often represented as points
Their attribute values can be represented as the position
of the points or the characteristics of the points, e.g.,
color, size, and shape
If position is used, then the relationships of points, i.e.,
whether they form groups or a point is an outlier, is easily
perceived.
Prof. Pier Luca Lanzi
27. Arrangement 27
Is the placement of visual elements within a display
Can make a large difference in how easy
it is to understand the data
Example:
Prof. Pier Luca Lanzi
28. Selection 28
Is the elimination or the de-emphasis of
certain objects and attributes
Selection may involve the chossing a subset of attributes
Dimensionality reduction is often used to reduce the
number of dimensions to two or three
Alternatively, pairs of attributes can be considered
Selection may also involve choosing a subset of objects
A region of the screen can only show so many points
Can sample, but want to preserve points in sparse areas
Prof. Pier Luca Lanzi
29. Visualization Techniques: Histograms 29
Histogram
Usually shows the distribution of values of a single
variable
Divide the values into bins and show a bar plot of the
number of objects in each bin.
The height of each bar indicates the number of objects
Shape of histogram depends on the number of bins
Example: Petal Width (10 and 20 bins, respectively)
Prof. Pier Luca Lanzi
30. Two-Dimensional Histograms 30
Show the joint distribution of the values of two attributes
Example: petal width and petal length
What does this tell us?
Prof. Pier Luca Lanzi
31. Visualization Techniques: Box Plots 31
Box Plots
Invented by J. Tukey
Another way of displaying the distribution of data
Following figure shows the basic part of a box plot
outlier
10th percentile
75th percentile
50th percentile
25th percentile
10th percentile
Prof. Pier Luca Lanzi
32. Example of Box Plots 32
Box plots can be used to compare attributes
Prof. Pier Luca Lanzi
33. Visualization Techniques: Scatter Plots 33
Attributes values determine the position
Two-dimensional scatter plots most common, but can have
three-dimensional scatter plots
Often additional attributes can be displayed by using the
size, shape, and color of the markers that represent the
objects
It is useful to have arrays of scatter plots can compactly
summarize the relationships of several pairs of attributes
Prof. Pier Luca Lanzi
35. Visualization Techniques: Contour Plots 35
Useful when a continuous attribute is measured on a spatial
grid
They partition the plane into regions of similar values
The contour lines that form the boundaries of these regions
connect points with equal values
The most common example is contour maps of elevation
Can also display temperature, rainfall, air pressure, etc.
Prof. Pier Luca Lanzi
37. Visualization Techniques: Matrix Plots 37
Can plot the data matrix
This can be useful when objects are sorted according to class
Typically, the attributes are normalized to prevent one
attribute from dominating the plot
Plots of similarity or distance matrices can also be useful for
visualizing the relationships between objects
Examples of matrix plots are presented on the next two slides
Prof. Pier Luca Lanzi
38. Visualization of the Iris Data Matrix 38
standard
deviation
Prof. Pier Luca Lanzi
40. Visualization Techniques: 40
Parallel Coordinates
Used to plot the attribute values of high-dimensional data
Instead of using perpendicular axes, use a set of parallel
axes
The attribute values of each object are plotted as a point on
each corresponding coordinate axis and the points are
connected by a line
Thus, each object is represented as a line
Often, the lines representing a distinct class of objects group
together, at least for some attributes
Ordering of attributes is important in seeing such groupings
Prof. Pier Luca Lanzi
42. Other Visualization Techniques 42
Star Plots
Similar approach to parallel coordinates,
but axes radiate from a central point
The line connecting the values of an object is a polygon
Chernoff Faces
Approach created by Herman Chernoff
This approach associates each attribute with a
characteristic of a face
The values of each attribute determine the appearance of
the corresponding facial characteristic
Each object becomes a separate face
Relies on human’s ability to distinguish faces
Prof. Pier Luca Lanzi
43. Star Plots for Iris Data 43
Setosa
Versicolour
Virginica
Prof. Pier Luca Lanzi
44. Chernoff Faces for Iris Data 44
Setosa
Versicolour
Virginica
Prof. Pier Luca Lanzi
45. Why Data Preprocessing? 45
Data in the real world is dirty
Incomplete: lacking attribute values, lacking certain
attributes of interest, or containing only aggregate data
e.g., occupation=“ ”
Noisy: containing errors or outliers
e.g., Salary=“-10”
Inconsistent: containing discrepancies in codes or names
e.g., Age=“42” Birthday=“03/07/1997”
e.g., Was rating “1,2,3”, now rating “A, B, C”
e.g., discrepancy between duplicate records
Prof. Pier Luca Lanzi
46. Why Is Data Dirty? 46
Incomplete data may come from
“Not applicable” data value when collected
Different considerations between the time when the data
was collected and when it is analyzed.
Human/hardware/software problems
Noisy data (incorrect values) may come from
Faulty data collection instruments
Human or computer error at data entry
Errors in data transmission
Inconsistent data may come from
Different data sources
Functional dependency violation (e.g., modify some linked
data)
Duplicate records also need data cleaning
Prof. Pier Luca Lanzi
47. Why Is Data Preprocessing Important? 47
No quality data, no quality mining results!
Quality decisions must be based on quality data
E.g., duplicate or missing data may cause incorrect or
even misleading statistics.
Data warehouse needs consistent integration of quality data
Data extraction, cleaning, and transformation comprises the
majority of the work of building a data warehouse
Prof. Pier Luca Lanzi
48. Data Quality 48
What kinds of data quality problems?
How can we detect problems with the data?
What can we do about these problems?
Examples of data quality problems:
noise and outliers
missing values
duplicate data
Prof. Pier Luca Lanzi
49. Multi-Dimensional Measure of 49
Data Quality
A well-accepted multidimensional view:
Accuracy
Completeness
Consistency
Timeliness
Believability
Value added
Interpretability
Accessibility
Broad categories:
Intrinsic, contextual, representational, and accessibility
Prof. Pier Luca Lanzi
50. Noise 50
Noise refers to modification of original values
Examples: distortion of a person’s voice when talking on a
poor phone and “snow” on television screen
Two Sine Waves Two Sine Waves + Noise
Prof. Pier Luca Lanzi
51. Outliers 51
Outliers are data objects with characteristics that are
considerably different than most of the other data objects in
the data set
Prof. Pier Luca Lanzi
52. Missing Values 52
Reasons for missing values
Information is not collected
(e.g., people decline to give their age and weight)
Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)
Handling missing values
Eliminate Data Objects
Estimate Missing Values
Ignore the Missing Value During Analysis
Replace with all possible values (weighted by their
probabilities)
Prof. Pier Luca Lanzi
53. Duplicate Data 53
Data set may include data objects that are duplicates, or
almost duplicates of one another
Major issue when merging data from heterogeous sources
Examples: same person with multiple email addresses
Data cleaning: process of dealing with duplicate data issues
Prof. Pier Luca Lanzi
54. Data Cleaning as a Process 54
Data discrepancy detection
Use metadata (e.g., domain, range, dependency, distribution)
Check field overloading
Check uniqueness rule, consecutive rule and null rule
Use commercial tools
• Data scrubbing: use simple domain knowledge (e.g., postal code,
spell-check) to detect errors and make corrections
• Data auditing: by analyzing data to discover rules and relationship
to detect violators (e.g., correlation and clustering to find outliers)
Data migration and integration
Data migration tools: allow transformations to be specified
ETL (Extraction/Transformation/Loading) tools: allow users to
specify transformations through a graphical user interface
Integration of the two processes
Iterative and interactive (e.g., Potter’s Wheels)
Prof. Pier Luca Lanzi
55. Data Preprocessing 55
Aggregation
Sampling
Dimensionality Reduction
Feature subset selection
Feature creation
Discretization and Binarization
Attribute Transformation
Prof. Pier Luca Lanzi
56. Aggregation 56
Combining two or more attributes (or objects)
into a single attribute (or object)
Purpose
Data reduction: reduce the number of attributes or objects
Change of scale: cities aggregated into regions, states,
countries, etc
More “stable” data: aggregated data tends to have less
variability
Prof. Pier Luca Lanzi
57. Aggregation 57
Variation of Precipitation in Australia
Standard Deviation of Average Standard Deviation of Average
Monthly Precipitation Yearly Precipitation
Prof. Pier Luca Lanzi
58. Sampling 58
Sampling is the main technique employed for data selection
It is often used for both the preliminary investigation of the
data and the final data analysis.
Statisticians sample because obtaining the entire set of data
of interest is too expensive or time consuming
Sampling is used in data mining because processing the
entire set of data of interest is too expensive or time
consuming
Prof. Pier Luca Lanzi
59. Key principles for Effective Sampling 59
Using a sample will work almost as well as using the entire
data sets, if the sample is representative
A sample is representative if it has approximately the same
property (of interest) as the original set of data
Prof. Pier Luca Lanzi
60. Types of Sampling 60
Simple Random Sampling
There is an equal probability of selecting any particular item
Sampling without replacement
As each item is selected, it is removed from the population
Sampling with replacement
Objects are not removed from the population as they are
selected for the sample.
In sampling with replacement, the same object can
be picked up more than once
Stratified sampling
Split the data into several partitions
Then draw random samples from each partition
Prof. Pier Luca Lanzi
62. Sample Size 62
What sample size is necessary to get at least
one object from each of 10 groups.
Prof. Pier Luca Lanzi
63. Curse of Dimensionality 63
When dimensionality increases,
data becomes increasingly sparse
in the space that it occupies
Definitions of density and
distance between points, which is
critical for clustering and outlier
detection, become less meaningful
•Randomly generate 500 points
•Compute difference between max and
min distance between any pair of points
Prof. Pier Luca Lanzi
64. Dimensionality Reduction 64
Purpose:
Avoid curse of dimensionality
Reduce amount of time and memory required by data
mining algorithms
Allow data to be more easily visualized
May help to eliminate irrelevant features or reduce noise
Techniques
Principle Component Analysis
Singular Value Decomposition
Others: supervised and non-linear techniques
Prof. Pier Luca Lanzi
65. Dimensionality Reduction: 65
Principal Component Analysis (PCA)
Given N data vectors from n-dimensions, find k ≤ n orthogonal
vectors (principal components) that can be best used to represent
data
Steps
Normalize input data: Each attribute falls within the same range
Compute k orthonormal (unit) vectors, i.e., principal
components
Each input data (vector) is a linear combination of the k
principal component vectors
The principal components are sorted in order of decreasing
“significance” or strength
Since the components are sorted, the size of the data can be
reduced by eliminating the weak components, i.e., those with
low variance. (i.e., using the strongest principal components, it
is possible to reconstruct a good approximation of the original
data
Works for numeric data only
Used when the number of dimensions is large
Prof. Pier Luca Lanzi
67. Dimensionality Reduction: PCA 67
Goal is to find a projection that captures the largest amount
of variation in data
x2
e
x1
Prof. Pier Luca Lanzi
68. Dimensionality Reduction: PCA 68
Find the eigenvectors of the covariance matrix
The eigenvectors define the new space
x2
e
x1
Prof. Pier Luca Lanzi
69. Feature Subset Selection 69
Another way to reduce dimensionality of data
Redundant features
duplicate much or all of the information contained in one
or more other attributes
Example: purchase price of a product and the amount of
sales tax paid
Irrelevant features
contain no information that is useful for the data mining
task at hand
Example: students' ID is often irrelevant to the task of
predicting students' GPA
Prof. Pier Luca Lanzi
70. Feature Subset Selection 70
Brute-force approach
Try all possible feature subsets as input to data mining algorithm
Embedded approaches
Feature selection occurs naturally as part of
the data mining algorithm
Filter approaches
Features are selected using a procedure that is
independent from a specific data mining algorithm
E.g., attributes are selected based on correlation measures
Wrapper approaches:
Use a data mining algorithm as a black box
to find best subset of attributes
E.g., apply a genetic algorithm and an algorithm for decision tree
to find the best set of features for a decision tree
Prof. Pier Luca Lanzi
71. Feature Creation 71
Create new attributes that can capture the important
information in a data set much more efficiently than the
original attributes
E.g., given the birthday, create the attribute age
Three general methodologies:
Feature Extraction: domain-specific
Mapping Data to New Space
Feature Construction: combining features
Prof. Pier Luca Lanzi
72. Mapping Data to a New Space 72
Fourier transform
Wavelet transform
Two Sine Waves Two Sine Waves + Noise Frequency
Prof. Pier Luca Lanzi
73. Discretization 73
Three types of attributes:
Nominal: values from an unordered set, e.g., color
Ordinal: values from an ordered set,
e.g., military or academic rank
Continuous: real numbers,
e.g., integer or real numbers
Discretization:
Divide the range of a continuous attribute into intervals
Some classification algorithms only accept categorical
attributes
Reduce data size by discretization
Prepare for further analysis
Prof. Pier Luca Lanzi
74. Discretization Approaches 74
Supervised
Attributes are discretized using the class information
Generates intervals that tries to minimize the loss of
information about the class
Unsupervised
Attributes are discretized solely based on their values
Prof. Pier Luca Lanzi
75. Discretization Using Class Labels 75
Entropy based approach
3 categories for both x and y 5 categories for both x and y
Prof. Pier Luca Lanzi
76. Discretization Without Using Class Labels 76
Data Equal interval width
Equal frequency K-means
Prof. Pier Luca Lanzi
77. Discretization and Concept Hierarchy 77
Discretization
Reduce the number of values for a given continuous attribute
by dividing the range of the attribute into intervals
Interval labels can then be used to replace actual data values
Supervised vs. unsupervised
Split (top-down) vs. merge (bottom-up)
Discretization can be performed recursively on an attribute
Concept hierarchy formation
Recursively reduce the data by collecting and replacing low level
concepts (such as numeric values for age) by higher level
concepts (such as young, middle-aged, or senior)
Prof. Pier Luca Lanzi
78. Typical Discretization Methods 78
Entropy-based discretization:
supervised, top-down split
Interval merging by χ2 Analysis:
supervised, bottom-up merge
Segmentation by natural partitioning:
top-down split, unsupervised
Prof. Pier Luca Lanzi
79. Entropy-Based Discretization 79
Given a set of samples S, if S is partitioned into two intervals S1
and S2 using boundary T, the information gain after partitioning is
|S |
| S1 |
I (S , T ) = Entropy ( S 1) + 2 Entropy ( S 2 )
|S| |S|
Entropy is calculated based on class distribution of the samples in
the set. Given m classes, the entropy of S1 is
m
Entropy ( S 1 ) = − ∑ p i log 2 ( p i )
i =1
where pi is the probability of class i in S1
The boundary that minimizes the entropy function over all possible
boundaries is selected as a binary discretization
The process is recursively applied to partitions obtained until some
stopping criterion is met
Such a boundary may reduce data size and improve classification
accuracy
Prof. Pier Luca Lanzi
80. Interval Merge by χ2 Analysis 80
Merging-based (bottom-up) vs. splitting-based methods
Merge: Find the best neighboring intervals and merge them
to form larger intervals recursively
ChiMerge [Kerber AAAI 1992, See also Liu et al. DMKD 2002]
Initially, each distinct value of a numerical attr. A is
considered to be one interval
χ2 tests are performed for every pair of adjacent intervals
Adjacent intervals with the least χ2 values are merged
together, since low χ2 values for a pair indicate similar
class distributions
This merge process proceeds recursively until a
predefined stopping criterion is met (such as significance
level, max-interval, max inconsistency, etc.)
Prof. Pier Luca Lanzi
81. Segmentation by Natural Partitioning 81
A simply 3-4-5 rule can be used to segment numeric data
into relatively uniform, “natural” intervals.
If an interval covers 3, 6, 7 or 9 distinct values at the most
significant digit, partition the range into 3 equi-width
intervals
If it covers 2, 4, or 8 distinct values at the most significant
digit, partition the range into 4 intervals
If it covers 1, 5, or 10 distinct values at the most significant
digit, partition the range into 5 intervals
Prof. Pier Luca Lanzi
83. Attribute Transformation 83
A function that maps the entire set of values of a given
attribute to a new set of replacement values such that each
old value can be identified with one of the new values
Simple functions: xk, log(x), ex, |x|
Standardization and Normalization
Prof. Pier Luca Lanzi
84. On-Line Analytical Processing (OLAP) 84
Relational databases put data into tables, while OLAP uses a
multidimensional array representation.
Such representations of data previously existed in statistics
and other fields
There are a number of data analysis and data exploration
operations that are easier with such a data representation.
Prof. Pier Luca Lanzi
85. Creating a Multidimensional Array 85
First, identify which attributes are to be the dimensions and
which attribute is to be the target attribute whose values
appear as entries in the multidimensional array.
The attributes used as dimensions must have discrete
values
The target value is typically a count or continuous value,
e.g., the cost of an item
Can have no target variable at all except the count of
objects that have the same set of attribute values
Second, find the value of each entry in the multidimensional
array by summing the values (of the target attribute) or
count of all objects that have the attribute values
corresponding to that entry.
Prof. Pier Luca Lanzi
86. Example: Iris data 86
We show how the attributes, petal length, petal width, and
species type can be converted to a multidimensional array
First, we discretized the petal width and length to have
categorical values: low, medium, and high
We get the following table - note the count attribute
Prof. Pier Luca Lanzi
87. Example: Iris data (continued) 87
Each unique tuple of petal width, petal length, and species
type identifies one element of the array.
This element is assigned the corresponding count value.
The figure illustrates
the result.
All non-specified
tuples are 0.
Prof. Pier Luca Lanzi
88. Example: Iris data (continued) 88
Slices of the multidimensional array are shown by the
following cross-tabulations
What do these tables tell us?
Prof. Pier Luca Lanzi
89. OLAP Operations: Data Cube 89
The key operation of a OLAP is the formation of a data cube
A data cube is a multidimensional representation of data,
together with all possible aggregates.
By all possible aggregates, we mean the aggregates that
result by selecting a proper subset of the dimensions and
summing over all remaining dimensions.
For example, if we choose the species type dimension of the
Iris data and sum over all other dimensions, the result will be
a one-dimensional entry with three entries, each of which
gives the number of flowers of each type.
Prof. Pier Luca Lanzi
90. Data Cube Example 90
Consider a data set that records the sales of products at a
number of company stores at various dates.
This data can be represented
as a 3 dimensional array
There are 3 two-dimensional
aggregates (3 choose 2 ),
3 one-dimensional aggregates,
and 1 zero-dimensional
aggregate (the overall total)
Prof. Pier Luca Lanzi
91. Data Cube Example (continued) 91
The following figure table shows one of the two dimensional
aggregates, along with two of the one-dimensional
aggregates, and the overall total
Prof. Pier Luca Lanzi
92. OLAP Operations: Slicing and Dicing 92
Slicing is selecting a group of cells from the entire
multidimensional array by specifying a specific value for one
or more dimensions.
Dicing involves selecting a subset of cells by specifying a
range of attribute values.
This is equivalent to defining a subarray from the
complete array.
In practice, both operations can also be accompanied by
aggregation over some dimensions.
Prof. Pier Luca Lanzi
93. OLAP Operations: Roll-up and Drill-down 93
Attribute values often have a hierarchical structure.
Each date is associated with a year, month, and week.
A location is associated with a continent, country, state
(province, etc.), and city.
Products can be divided into various categories, such as
clothing, electronics, and furniture.
Note that these categories often nest and form a tree or
lattice
A year contains months which contains day
A country contains a state which contains a city
Prof. Pier Luca Lanzi
94. OLAP Operations: Roll-up and Drill-down 94
This hierarchical structure gives rise to the roll-up and drill-
down operations.
For sales data, we can aggregate (roll up) the sales
across all the dates in a month.
Conversely, given a view of the data where the time
dimension is broken into months, we could split the
monthly sales totals (drill down) into daily sales totals.
Likewise, we can drill down or roll up on the location or
product ID attributes.
Prof. Pier Luca Lanzi
95. Data Compression 95
String compression
There are extensive theories and well-tuned algorithms
Typically lossless
But only limited manipulation is possible without
expansion
Audio/video compression
Typically lossy compression, with progressive refinement
Sometimes small fragments of signal can be
reconstructed without reconstructing the whole
Time sequence is not audio
Typically short and vary slowly with time
Prof. Pier Luca Lanzi
96. 96
Dimensionality Reduction:
Wavelet Transformation
Haar2 Daubechie4
Discrete wavelet transform (DWT): linear signal processing, multi-
resolutional analysis
Compressed approximation: store only a small fraction of the
strongest of the wavelet coefficients
Similar to discrete Fourier transform (DFT), but better lossy
compression, localized in space
Method:
Length, L, must be an integer power of 2 (padding with 0’s, when
necessary)
Each transform has 2 functions: smoothing, difference
Applies to pairs of data, resulting in two set of data of length L/2
Applies two functions recursively, until reaches the desired length
Prof. Pier Luca Lanzi
97. Concept Hierarchy Generation 97
for Categorical Data
Specification of a partial/total ordering of attributes explicitly
at the schema level by users or experts
street < city < state < country
Specification of a hierarchy for a set of values by explicit
data grouping
{Urbana, Champaign, Chicago} < Illinois
Specification of only a partial set of attributes
E.g., only street < city, not others
Automatic generation of hierarchies (or attribute levels) by
the analysis of the number of distinct values
E.g., for a set of attributes: {street, city, state, country}
Prof. Pier Luca Lanzi
98. Automatic Concept Hierarchy Generation 98
Some hierarchies can be automatically generated based on
the analysis of the number of distinct values per attribute in
the data set
The attribute with the most distinct values is placed at the
lowest level of the hierarchy
Exceptions, e.g., weekday, month, quarter, year
Country 15 distinct values
Province 365 distinct values
City 3567 distinct values
Street 674,339 distinct values
Prof. Pier Luca Lanzi
99. Summary 99
Data exploration and preparation, or preprocessing, is a big
issue for both data warehousing and data mining
Descriptive data summarization is need for quality data
preprocessing
Data preparation includes
Data cleaning and data integration
Data reduction and feature selection
Discretization
A lot a methods have been developed but data preprocessing
still an active area of research
Prof. Pier Luca Lanzi