SlideShare a Scribd company logo
1 of 29
Synthetic Biology:
The next generation of biotechnology

Christina D. Smolke
Department of Bioengineering
Stanford University


July 9, 2012
LASER Talk, University of San Francisco
Engineering systems

                               Circuitry
                               Sensors (Inputs)                                  Circuitry
                                signal processing         remote control           Signal Processing
                                 Temperature    Chemicals memory
                                automated response                                 Automated Response
      Sensors (Inputs)           Light
                                dynamic controlTouch      communication            Dynamic Control      Memor
      chemicals                  Remote control Communication
      biomolecules
      temperature
      light




                                                        Actuators (Outputs)
       Actuators (Outputs)                                Motility   Reporting
       reporting     phenotype                            Delivery   Self-Organization
       delivery      self-organization                    Modify Environment
       motility      synthesis
Synthetic biology

ensors (Inputs)                                Circuitry
                                               Circuitry
Temperature      Chemicals                       signalProcessing
                                                  Signal processing    remote control
Light                                            Automated Response
                                                 automated response    memory
                 Touch
                    Sensors (Inputs)
                 Communication                   dynamicControl
                                                  Dynamic control Memory
                                                                       communication
Remote control
                      chemicals
                      biomolecules
                      temperature
                      light




                        Actuators (Outputs)
                     Actuators (Outputs)
                           Motility    Reporting
                     reporting        phenotype
                            Delivery self-organization
                     delivery         Self-Organization
                     motility         synthesis
                           Modify Environment
Tools driving genetic engineering
              Recombinant DNA          Polymerase Chain Reaction           DNA Sequencing




First
Gen.
Biotech
          =
              Basic “Cut” & “Paste”   Amplify & Make Simple Changes   Read Out the Genetic Code

   Insulin Production                   Erythropoietin Production




                                                                               ?
                                                                           10-1000’s genes
                                                                         complex chemicals
                                                                            & materials
                                                                           organisms as
                                                                             products
            1973                                   1985
                                                                                     ….
bacterial cell culture, 1 gene          mammalian cell culture, 1 gene
Ongoing tools revolution
              Recombinant DNA          Polymerase Chain Reaction           DNA Sequencing




First
Gen.
Biotech
          =
              Basic “Cut” & “Paste”   Amplify & Make Simple Changes   Read Out the Genetic Code




Next
Gen.
Biotech
Adds      =                                                                      ...
New
Tools

                                                                              c/o D. Endy (Stanford University)
Transformative advances in fabrication platforms




             DNA Construction = #1 Tech. of 21st Ctry.

             From absract
             information to
             physical, living
             DNA designs.
        Organic chemistry                                            Biochemistry
nstruction = #1 Tech. of 21st Ctry.
                   TAATACGACTCACTATAGGGAGA
                                           …TAATGCAGCTTATTACA…(<200 nt)
                                                                     enzymes
                                           2004: 10,000 bp
                                           2010: 1,000,000 bp
                                           2016: 100 million?

                                                                26             (~1000 –
ATACGACTCACTATAGGGAGA                                                          10000 bp)
     A T G C
Transformative advances in fabrication platforms




                                           Carr PA, Church GM. 2009. Nat Biotech. 27: 1151-1162


Cellular (in vivo) assembly
                                  1 Mb+
                                           engineered




                                                natural

                         genome
                         transplantation              Gibson DG, et al. 2010. Science. 329: 52-6
Now that we can
write in DNA, what
    do we say?

Challenge: Design Gap
Buffe




                                                                                                                                                                                                                                                                          Inverter1+Invert
                                                                                                                                                                                             Buff




                                                                                                                                                                                                                                                                                                                                    Inver
                                                                                                                                                                                                                2xInvert
                                                                                                                                                                                                                  Invert




                                                                                                                                                                                                                                                                                                                                  2xInver
                                                                                                                                                                                                                           Buffer1+Buff
                                                                                                                                                                                2xBuf




                                                                                                                                                                                                                                                                                                             2xBuf
                                                                                                                                                                                                       Inver




                                                                                                                                                                                                                                                                                                               Buf
                                                                                                                                                                                                     2xInver




                                                                                                                                                                                                                                                                                                                      2xBuf
                                                                                                                                                                                  Buf




                                                                                                                                                                                           2xBuf




                                                                                                                                                                                                                                                                                                                        Buf
                                                                                                                                                                                                                                                                                                   2xBuff
                                                                                                                                                           D




                                                                                                                                                                                                                                                                                                     Buff
                                                                                                                                                                      2xBuff
                                                                                               output protein (high when AA)




                 Biomanufacturing Platforms                                      Next-Generation Therapies
                                                                                 C AND gate                                                                                                                                                 D16                                                                            14.0




                                                                                                                                                                                                                                     Device response in unit expression
                                                                                                                                                                                                                                                                               14
                                                                                   A                                              input A                                        input B
                                                                                              AB       output




                                                                                                                                                                                                                                                                                                 Apps
                                                                                   B                                                                                                                                                                                           12
                                                                                                                    [SI 1.2]
                                                                                        A       B      output                                                                                                                                                                  10
                                                                                       theo     tc      GFP
                                                                                                                                                                                                                                                                                     8
                                                                                        0          0     0
                                                                                        0          1     0                                                                                                                                                                           6
                                                                                        1          0     0                                                                                                                                                                           4                               3.1
                                                                                                                                                                                                               AAAAA
                           AAA




                                                                                        1          1     1                                                                                                                                                                                                  2.0
                                                                                                                                                                                                                                                                                     2
                                                                                                                                                                                                                                                                                                    0
                                                                                                                                                                                                                                                                                     0
                                                                                                                                                                                                                                                                                             GFP low low low high
                                                                                                                                                  output protein (high when AB)                                                                                                              theo     +       +
                                                                                                                                                                                                                                                                                             tc            + +

                                                Scalable Biological Computation
                                                                        E NOR gate                                                                                                                                                                F                                    10
                                                                                                                                                                                                                                                                                             9      8.1




                                                                                                                                                                                                                                          Device response in unit expression
                                                                                                                                                 input A                             input B




                                                                                                                                                                                                                                                                                                 Circuits
                                                                                   A                                                                                                                                                                                                         8
                                                                                              A+B       output
                                                                                   B                                                                                                                                                                                                         7
                                                                                                                    [SI 1.3]
                                                                                        A       B      output                                                                                                                                                                                6
                                                                                       theo     tc      GFP                                                                                                                                                                                  5
                                                                                        0          0     1                                                                                                                                                                                   4
                                                                                        0          1     0
                                                                                                                                                                                                                                                                                             3               2.0
                                                                                        1          0     0
                                                                                                                                                                                                               AAAAA                                                                         2                       1.1
                                                                                        1          1     0
                                                                                                                                                                                                                                                                                             1                                0
                                                                                                                                                                                                                                                                                             0
                                                                                                                                                                                                                                                                                              GFP high low low low
                                                                                                                                                    output protein (high when A+B)
                                                                                                                                                                                                                                                                                              theo     +        +
                                                                                                                                                                                                                                                                                              tc           + +

input module               actuator module                    output module            assembled RNA device
                                        I/O Tools                                              Spatial Engineering             Figure 2 F Win and Smolke
protein sensor      alternative exon inclusion                gene of interest




                                                                                                                                                                                                                                                                                                 Tools
                                                                                                                                                                                 Golgi

                                                                                                                                                           Vacuole

                  +                                      +          GOI                                                                                           GOI




                                                                                                                output
                                 3’ss    5’ss




                                                                                                                                                                                               ER

                                                                                  The identity of the RNA sensor and




                                                                                                                                Mitochondrion





                                                                                                                                                                                          Nucleus

                                                                                 its location in the intronic space will
                                                                                 determine the effect of input binding
                      exon inclusion    exon exclusion                                                  input A
                                                                                         on the device output.
                   (low device output) (high device output)


                                           The Smolke Laboratory
Molecular computers enable programming of function
input
                         sensor1 / transmitter1 / actuator




                                                                   output
                                                                            input A

                         sensor1 / transmitter2 / actuator




                                                                   output
                                                                            input A

                         sensor2 / transmitter1 / actuator




                                                                   output
                                                                            input B


                output

 input                                                                  output


                                      Win MN, Smolke CD. 2007. PNAS. 104: 14283-8
Molecular computers enable programming of function
input
                                                sensor1 / transmitter1 / actuator




                                                                                    output
                                                                                             input A

                                                sensor1 / transmitter2 / actuator




                                                                                    output
                                                                                             input A

                                                sensor2 / transmitter1 / actuator




                                                                                    output
                                                                                             input B


                                     output
                                                n sensors / n transmitters / actuator
                                                                                      A      B output
                                                                                      0      0   1
                                                                                      0      1   1
                                                                                      1      0   1
                                                                                      1      1   0
Win MN, Smolke CD. 2008. Science. 322: 456-60
Fluorescence low



                                       GFP   AAA Atropine
Cellular biosynthesis                        Muscarinic blocker
platforms
                                       GFP   AAA
                                                   Paclitaxel
                                                    Cancer
                     Ligand present
                   Ribozyme inactive   GFP   AAA
                   Fluorescence high
                                                     Digoxin
                                                   Arrhythmias



                                                   Ceftaroline
                                                   Antibiotic



                                                   Prostratin
                                                      HIV
                                                                  1
                                                                  2
H 3 CO              H 3CO


                                                                                                                                              NCH3           NCH 3
                                                                                                                                     HO                HO



                                                                                                                                                        O

                                                                                                                                                        OH
                                                                                                                                                                     antimicrobial
                  Norcoclaurine             Coclaurine         N-Methylcoclaurine                                                                                      anticancer
                                                                                                                                             Berbamunine

 Tyrosine
                                                                                                                                                                     BisBIAs
                                                                                     3’-Hydroxy-N-
                                                                                    methylcoclaurine
antiviral       Norlaudanosoline         6-O-Methyl-
                                       norlaudanosoline




                                                                                    Reticuline       hair growth

    Salutaridinol-7-        Salutaridinol           Salutaridine
      O-acetate




                                                                                    Scoulerine                 Tetrahydro-                 Canadine                    Berberine
                                                                                                              columbamine

      Thebaine               Neopinone              Codeinone
                                                                                                               antimicrobial
                                                                                                                                              Berberine branch
                              analgesic                                                                         antioxidant
                             antitussive                                                   Cheilanthifoline


                                                         Codeine



                                                                                                                       Cis-N-                      Dihydro-            Sanguinarine
                                                                                                 Stylopine         Methylstylopine               sanguinarine

            Morphine branch                          Morphine                                                                             Sanguinarine branch
                                                                                                                    Hawkins KM, Smolke CD. 2008. Nat Chem Biol. 4: 564
Building a microbial drug factory




Enzymes catalyze reactions:
Building a microbial drug factory




    Bis-BIAs           Sanguinarine /            Morphinan
                     Berberine Alkaloids         Alkaloids
                              O

                                      N
                              O

                                           OMe


                                           OMe
Building a microbial drug factory


                                                 DNA




                                                 protein



                                                 metabolite



    Bis-BIAs           Sanguinarine /            Morphinan
                     Berberine Alkaloids         Alkaloids
                              O

                                      N
                              O

                                           OMe


                                           OMe
Building a microbial drug factory




    Bis-BIAs           Sanguinarine /            Morphinan
                     Berberine Alkaloids         Alkaloids
                              O

                                      N
                              O

                                           OMe


                                           OMe
Building a microbial drug factory




    Bis-BIAs           Sanguinarine /            Morphinan
                     Berberine Alkaloids         Alkaloids
                              O

                                      N
                              O

                                           OMe


                                           OMe
Building a microbial drug factory




    Bis-BIAs           Sanguinarine /            Morphinan
                     Berberine Alkaloids         Alkaloids
                              O

                                      N
                              O

                                           OMe


                                           OMe
Molecular tools for optimizing metabolite production
Challenge: Often need to screen through large libraries of pathway/enzyme
variants – invasive / analytical procedures are too time and resource intensive

Solution: Engineer scalable platforms for noninvasive sensors of metabolite
concentrations in single living cells




                                    AAA                                AAA
I/O tools as noninvasive, real-time metabolite sensors


                                                                                       AAAA
                                                                        GFP
                                                      Ligand absent
                                                    Ribozyme active     GFP       AAA
                                                    Fluorescence low
                                                                Ligand absent
                                                              Ribozyme active GFP AAAA AAA
                                                                          GFP
                                                              Fluorescence low
                                                                                 AAA
                                                          Ligand absent GFP
                                                        Ribozyme active GFP        AAA
                                                        Fluorescence low
                                                                               GFP     AAA
                                                                        GFP
                                                                        GFP       AAA
                                                                                    AAAA

                                                                          GFP         AAA

                                                                                GFP          AAA
                                                      Ligand present
                                                    Ribozyme inactive   GFP
                                                                          GFP     AAA
                                                                                   AAA
                                                    Fluorescence high   GFP           AAAA
                                                               Ligand present
                                                             Ribozyme inactive GFP     AAA
Michener JK, Smolke CD. 2012. Metab Eng. In press            Fluorescence high
                                                         Ligand present
                                                        Ribozyme inactive GFP      AAA
Evolution… in the laboratory


                                       mutagenesis




                                                       …
                               identify best variant
          X
High-throughput enzyme library screening methods
                                                          plate-based assay
                                                          (library size: ~103)




                                           FACS-based screen
                                           (library size: ~106-107)




                            Molecular computer links enzyme
                            activity to fluorescence

                                Michener JK, Smolke CD. 2012. Metab Eng. In press
Li
                    2                                                                                                            0.1
                    a                          yCDM1 yCDM3 yCDM5 yCDM6 yCDM7 yCDM8 (-) Control        b                  1.8                                                                       300



                            α-actin α-V5
                                                                                                                                                                      KM, app
                    0                                                                                                    1.6     0.0                                  Selectivity
                                                                                                                                                                                                   250
                                                0%          20%      40%          60%          80%    100%1.4                                          0.0     0.2    0.4    0.6    0.8   1.0     1.2      1.4         1.6    1.8
                          Rapid Fluorescence Change of enzymes with improved activities
                                identification                        Relative Activity




                                                                                                          KM, app (mM)
                                                                                                                                                                                                   200




                                                                                                                                                                                                         Selectivity
                                                                                                                         1.2
                                                                                                                                                      35
c                   0.8
                                                                                                                     d1.0
                                                                                                                                                              vmax, app/KM, app                    150
                                                                                                                         0.8                          30
Library Frequency




                                                                                                                                                              Theophylline production




                                                                                                                                   Fold Improvement
                    0.7
                        Relative
                          Enzyme model1.0x
                             1.0x
                    Expression
                    0.6
                                  1.0x 1.2x                                    0.9x     0.7x   0.0x                      0.6
                                                                                                                         0.4
                                                                                                                                                      25
                                                                                                                                                                                                   100


                    0.5                                                                                                                                                                            50
                    c                                                                                                    0.2                          20
                    0.4                                                                                                  0.0                                                                       0
                                                                                                                               yCDM1 yCDM3 yCDM5 yCDM6 yCDM7 yCDM8
                    0.3                                                                                                                               15
                        0.2                                                                                              56
                                                                                                      d                                               10
                        0.1                                                                                              54

                        0.0                                                                                                                           5
                                                                                             Post-sort #3                52
                                     0.0        0.2                                         Post-sort #1




                                                                                                           T50 (oC)
                                                      0.4    0.6                           Pre-sort #1                   50                           0
                                                                   0.8   1.0                                                                                yCDM1   yCDM2   yCDM3   yCDM4 yCDM5     yCDM6 yCDM7              yCDM8
                                                                                  1.2                                    48
                                               Relative Activity                                                                                                     Plate Based                        FACS
                                                                                                                         46
                        a                        yCDM1 yCDM3 yCDM5 yCDM6 yCDM7 yCDM8 (-) Control
                                                                                                                         44b                          1.8                                                                    300
                                α-actin α-V5




                                                                                                                                                                                    KM, app
                                                                                                                                                      1.6                           Selectivity
                                                                                                                         42                                                                                                  250
                                                                                                                                                      1.4
                                                                                                                         40
                                                                                                                               Wildtype yCDM1 yCDM3 yCDM5 yCDM6 yCDM7 yCDM8

                                                                                                                                KM, app (mM)
                                                                                                                                                                                                                             200




                                                                                                                                                                                                                                   Selectivity
                                                                                                                                                      1.2
                                                                                                                                                      1.0
                                                                                                                                                                                                                             150
                                                                                                                                                      0.8
                         Relative                                                                                                                     0.6                                                                    100
                         Catalytic 1.0x 1.2x and selectivity
                               1.0x
                        Expression  activity 1.0x 0.9x 0.7x 0.0x
                                                                                                                                                      0.4
                         increases through evolutionary                                                                                                                                                                      50
                        c                                                                                                                             0.2
                         trajectory                                                                                                                   0.0
                                                                                                                                                            yCDM1 yCDM3 yCDM5 yCDM6 yCDM7 yCDM8
                                                                                                                                                                                                                             0


                        Michener JK, Smolke CD. 2012. Metab Eng. In press                                                                             56
                                                                                                                           d
                                                                                                                                                      54
Cellular therapies: engineering the immune system

                                                                   transfer engineered
                                                                   cells into patient




                                                                harvest lymphocytes
recover and engineer                                            from patient
desired cell type




http://www.discoverymedicine.com/Leslie-E-Huye/files/2010/03/
A molecular computer controlling immune response




                                                                   proliferation




                                                                    apoptosis /
                                                                      death




                           Chen YY, Jensen MC, Smolke CD. 2010. PNAS. 107: 8531-6
A molecular computer controlling immune response




                                              1.2E+09
                                                             L2bulge9(3x)
No
Theo

                                                            L2bulge9(3x) 0 uM Theo




                         Flux (photons/sec)
                                              1.0E+09
 No drug                                                     L2bulge9(3x)
500
μM
Theo

                                                            L2bulge9(3x) 500 uM Theo
                                              8.0E+08

                                              6.0E+08

                                              4.0E+08

                                              2.0E+08

                                              0.0E+00
                                                        0   2    4      6    8     10    12   14   16
                                                                     Days Post Injection

With drug




                                               Chen YY, Jensen MC, Smolke CD. 2010. PNAS. 107: 8531-6
Apps




Standardization   Abstraction    Synthesis   Device Design   Languages & Grammar


                                                             AGGTACAGTTATCA
                                                             CCCATTGCATGGTA
                                                             TTCAAAGAAGTCGT




                                                                                   output
                                                             GGCCCAGATTCGAC
                                                             AAATCGTGTAGTAA
                                                             TGGTCCAGCTGATT                 input


                                Tools                        GGTTCAAATAACGG
Postdoctoral Researchers             The Smolke Laboratory
Kate Thodey
Eric Hayden
Graduate Researchers
Ryan Bloom
Andy Chang
Leo d’Espaux
Stephanie Galanie
Katie Galloway
Drew Kennedy
Joe Liang
Melina Mathur
Josh Michener
Michael Siddiqui
Isis Trenchard
Jay Vowles        Alumni                   Collaborators
Yen-Hsiang Wang Andrew Babiskin            Michael Jensen (SCRI, FHCRC)
Kathy Wei         Travis Bayer
Remus Wong        Chase Beisel             Funding Sources
                  Yvonne Chen              Defense Advanced Research Projects
                  Stephanie Culler         Agency
                  Kristy Hawkins           Bill and Melinda Gates Foundation
                  Kevin Hoff               National Institutes of Health (NIGMS, NCI)
                  Maung Nyan Win           National Science Foundation (CBET, CCF)

More Related Content

Similar to Christina Smolke (Stanford) at a LASER on "Synthetic Biology"

Synthetic Biology: The next generation of biotechnology - Christina Smolke, S...
Synthetic Biology: The next generation of biotechnology - Christina Smolke, S...Synthetic Biology: The next generation of biotechnology - Christina Smolke, S...
Synthetic Biology: The next generation of biotechnology - Christina Smolke, S...Stanford School of Engineering
 
What Synthetic Biology Can Do For You
What Synthetic Biology Can Do For YouWhat Synthetic Biology Can Do For You
What Synthetic Biology Can Do For YouEric Ma
 
monsanto 08-23-05a
monsanto 08-23-05amonsanto 08-23-05a
monsanto 08-23-05afinance28
 
Cambridge Cleantech Members' Group - Zero Carbon Homes and Clean Energy
Cambridge Cleantech Members' Group - Zero Carbon Homes and Clean Energy  Cambridge Cleantech Members' Group - Zero Carbon Homes and Clean Energy
Cambridge Cleantech Members' Group - Zero Carbon Homes and Clean Energy crifcambs
 
Life Sciences De-Mystified - Mark Bünger - PICNIC '10
Life Sciences De-Mystified - Mark Bünger - PICNIC '10Life Sciences De-Mystified - Mark Bünger - PICNIC '10
Life Sciences De-Mystified - Mark Bünger - PICNIC '10PICNIC Festival
 
Bioinformatics introduction
Bioinformatics introductionBioinformatics introduction
Bioinformatics introductionBiotech Online
 
How Point of Care Diagnostics Will Change the Future of Health Care, Dr. Andr...
How Point of Care Diagnostics Will Change the Future of Health Care, Dr. Andr...How Point of Care Diagnostics Will Change the Future of Health Care, Dr. Andr...
How Point of Care Diagnostics Will Change the Future of Health Care, Dr. Andr...UT Austin McCombs School of Business
 
Medical device-innovation-convergence
Medical device-innovation-convergenceMedical device-innovation-convergence
Medical device-innovation-convergence3GDR
 
เทคโนโลยีชีวภาพ
เทคโนโลยีชีวภาพเทคโนโลยีชีวภาพ
เทคโนโลยีชีวภาพrosespots
 
LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010
LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010
LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010mzhou45
 
biocomputing-190618135550.pdf
biocomputing-190618135550.pdfbiocomputing-190618135550.pdf
biocomputing-190618135550.pdfRohithTopula
 
Biocomputing- biological computing
Biocomputing- biological computingBiocomputing- biological computing
Biocomputing- biological computingMaham Adnan
 
Cytoscape: Gene coexppression and PPI networks
Cytoscape: Gene coexppression and PPI networksCytoscape: Gene coexppression and PPI networks
Cytoscape: Gene coexppression and PPI networksBITS
 
Cebit Brochure01 31oct08
Cebit Brochure01 31oct08Cebit Brochure01 31oct08
Cebit Brochure01 31oct08martindudziak
 
OBC | Synthetic biology announcing the coming technological revolution
OBC | Synthetic biology announcing the coming technological revolutionOBC | Synthetic biology announcing the coming technological revolution
OBC | Synthetic biology announcing the coming technological revolutionOut of The Box Seminar
 
Teaching presentation
Teaching presentationTeaching presentation
Teaching presentationChoo Yang
 

Similar to Christina Smolke (Stanford) at a LASER on "Synthetic Biology" (20)

Synthetic Biology: The next generation of biotechnology - Christina Smolke, S...
Synthetic Biology: The next generation of biotechnology - Christina Smolke, S...Synthetic Biology: The next generation of biotechnology - Christina Smolke, S...
Synthetic Biology: The next generation of biotechnology - Christina Smolke, S...
 
What Synthetic Biology Can Do For You
What Synthetic Biology Can Do For YouWhat Synthetic Biology Can Do For You
What Synthetic Biology Can Do For You
 
monsanto 08-23-05a
monsanto 08-23-05amonsanto 08-23-05a
monsanto 08-23-05a
 
Cambridge Cleantech Members' Group - Zero Carbon Homes and Clean Energy
Cambridge Cleantech Members' Group - Zero Carbon Homes and Clean Energy  Cambridge Cleantech Members' Group - Zero Carbon Homes and Clean Energy
Cambridge Cleantech Members' Group - Zero Carbon Homes and Clean Energy
 
Life Sciences De-Mystified - Mark Bünger - PICNIC '10
Life Sciences De-Mystified - Mark Bünger - PICNIC '10Life Sciences De-Mystified - Mark Bünger - PICNIC '10
Life Sciences De-Mystified - Mark Bünger - PICNIC '10
 
Bioinformatics life sciences_2012
Bioinformatics life sciences_2012Bioinformatics life sciences_2012
Bioinformatics life sciences_2012
 
Bioinformatics introduction
Bioinformatics introductionBioinformatics introduction
Bioinformatics introduction
 
How Point of Care Diagnostics Will Change the Future of Health Care, Dr. Andr...
How Point of Care Diagnostics Will Change the Future of Health Care, Dr. Andr...How Point of Care Diagnostics Will Change the Future of Health Care, Dr. Andr...
How Point of Care Diagnostics Will Change the Future of Health Care, Dr. Andr...
 
Medical device-innovation-convergence
Medical device-innovation-convergenceMedical device-innovation-convergence
Medical device-innovation-convergence
 
ISyPeM
ISyPeMISyPeM
ISyPeM
 
เทคโนโลยีชีวภาพ
เทคโนโลยีชีวภาพเทคโนโลยีชีวภาพ
เทคโนโลยีชีวภาพ
 
Overview and Implications of Nanotechnology
Overview and Implications of NanotechnologyOverview and Implications of Nanotechnology
Overview and Implications of Nanotechnology
 
LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010
LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010
LC-IR Hyphenated Technology For Excipient Analysis-FDA USP Seminars-1-13-2010
 
CIMNA CRO Central Lab
CIMNA CRO Central LabCIMNA CRO Central Lab
CIMNA CRO Central Lab
 
biocomputing-190618135550.pdf
biocomputing-190618135550.pdfbiocomputing-190618135550.pdf
biocomputing-190618135550.pdf
 
Biocomputing- biological computing
Biocomputing- biological computingBiocomputing- biological computing
Biocomputing- biological computing
 
Cytoscape: Gene coexppression and PPI networks
Cytoscape: Gene coexppression and PPI networksCytoscape: Gene coexppression and PPI networks
Cytoscape: Gene coexppression and PPI networks
 
Cebit Brochure01 31oct08
Cebit Brochure01 31oct08Cebit Brochure01 31oct08
Cebit Brochure01 31oct08
 
OBC | Synthetic biology announcing the coming technological revolution
OBC | Synthetic biology announcing the coming technological revolutionOBC | Synthetic biology announcing the coming technological revolution
OBC | Synthetic biology announcing the coming technological revolution
 
Teaching presentation
Teaching presentationTeaching presentation
Teaching presentation
 

More from piero scaruffi

Art & Music in the Sixties
Art & Music in the SixtiesArt & Music in the Sixties
Art & Music in the Sixtiespiero scaruffi
 
When an artificial intelligence makes art, is it still art?
When an artificial intelligence makes art, is it still art?When an artificial intelligence makes art, is it still art?
When an artificial intelligence makes art, is it still art?piero scaruffi
 
Intelligence is not Artificial - Stanford, June 2016
Intelligence is not Artificial - Stanford, June 2016Intelligence is not Artificial - Stanford, June 2016
Intelligence is not Artificial - Stanford, June 2016piero scaruffi
 
The Best Kept Secret in Silicon Valley
The Best Kept Secret in Silicon ValleyThe Best Kept Secret in Silicon Valley
The Best Kept Secret in Silicon Valleypiero scaruffi
 
Consciousness, Self, Free Will
 Consciousness, Self, Free Will  Consciousness, Self, Free Will
Consciousness, Self, Free Will piero scaruffi
 
Selfies, Surveillance and the Voluntary Panopticon
Selfies, Surveillance and the Voluntary Panopticon Selfies, Surveillance and the Voluntary Panopticon
Selfies, Surveillance and the Voluntary Panopticon piero scaruffi
 
Machine Intelligence & Physics
Machine Intelligence & PhysicsMachine Intelligence & Physics
Machine Intelligence & Physicspiero scaruffi
 
Language, Dreams, Emotions
Language, Dreams, EmotionsLanguage, Dreams, Emotions
Language, Dreams, Emotionspiero scaruffi
 
Philosophy of Mind & Cognitive Psychology
Philosophy of Mind & Cognitive PsychologyPhilosophy of Mind & Cognitive Psychology
Philosophy of Mind & Cognitive Psychologypiero scaruffi
 
The Singularity and you
The Singularity and youThe Singularity and you
The Singularity and youpiero scaruffi
 
Birgitta Whaley (Berkeley Quantum Computation) at a LASER http://www.scaruffi...
Birgitta Whaley (Berkeley Quantum Computation) at a LASER http://www.scaruffi...Birgitta Whaley (Berkeley Quantum Computation) at a LASER http://www.scaruffi...
Birgitta Whaley (Berkeley Quantum Computation) at a LASER http://www.scaruffi...piero scaruffi
 
Tami Spector on "The Molecular Elusive"
Tami Spector on "The Molecular Elusive" Tami Spector on "The Molecular Elusive"
Tami Spector on "The Molecular Elusive" piero scaruffi
 
From Cosmology to Neuroscience to Rock Music and back
From Cosmology to Neuroscience to Rock Music and backFrom Cosmology to Neuroscience to Rock Music and back
From Cosmology to Neuroscience to Rock Music and backpiero scaruffi
 
Five Reasons why the Singularity is not coming any time soon
Five Reasons why the Singularity  is not coming any time soonFive Reasons why the Singularity  is not coming any time soon
Five Reasons why the Singularity is not coming any time soonpiero scaruffi
 
Artificial intelligence and the Singularity - History, Trends and Reality Check
Artificial intelligence and the Singularity - History, Trends and Reality CheckArtificial intelligence and the Singularity - History, Trends and Reality Check
Artificial intelligence and the Singularity - History, Trends and Reality Checkpiero scaruffi
 
History of Thought - Part 6: The Modern Age
History of Thought - Part 6: The Modern AgeHistory of Thought - Part 6: The Modern Age
History of Thought - Part 6: The Modern Agepiero scaruffi
 

More from piero scaruffi (20)

Art & Music in the Sixties
Art & Music in the SixtiesArt & Music in the Sixties
Art & Music in the Sixties
 
A Herstory of Women
A Herstory of WomenA Herstory of Women
A Herstory of Women
 
When an artificial intelligence makes art, is it still art?
When an artificial intelligence makes art, is it still art?When an artificial intelligence makes art, is it still art?
When an artificial intelligence makes art, is it still art?
 
Intelligence is not Artificial - Stanford, June 2016
Intelligence is not Artificial - Stanford, June 2016Intelligence is not Artificial - Stanford, June 2016
Intelligence is not Artificial - Stanford, June 2016
 
temp
temptemp
temp
 
The Best Kept Secret in Silicon Valley
The Best Kept Secret in Silicon ValleyThe Best Kept Secret in Silicon Valley
The Best Kept Secret in Silicon Valley
 
Consciousness, Self, Free Will
 Consciousness, Self, Free Will  Consciousness, Self, Free Will
Consciousness, Self, Free Will
 
Selfies, Surveillance and the Voluntary Panopticon
Selfies, Surveillance and the Voluntary Panopticon Selfies, Surveillance and the Voluntary Panopticon
Selfies, Surveillance and the Voluntary Panopticon
 
Machine Intelligence & Physics
Machine Intelligence & PhysicsMachine Intelligence & Physics
Machine Intelligence & Physics
 
Life
LifeLife
Life
 
Language, Dreams, Emotions
Language, Dreams, EmotionsLanguage, Dreams, Emotions
Language, Dreams, Emotions
 
The Brain
The BrainThe Brain
The Brain
 
Philosophy of Mind & Cognitive Psychology
Philosophy of Mind & Cognitive PsychologyPhilosophy of Mind & Cognitive Psychology
Philosophy of Mind & Cognitive Psychology
 
The Singularity and you
The Singularity and youThe Singularity and you
The Singularity and you
 
Birgitta Whaley (Berkeley Quantum Computation) at a LASER http://www.scaruffi...
Birgitta Whaley (Berkeley Quantum Computation) at a LASER http://www.scaruffi...Birgitta Whaley (Berkeley Quantum Computation) at a LASER http://www.scaruffi...
Birgitta Whaley (Berkeley Quantum Computation) at a LASER http://www.scaruffi...
 
Tami Spector on "The Molecular Elusive"
Tami Spector on "The Molecular Elusive" Tami Spector on "The Molecular Elusive"
Tami Spector on "The Molecular Elusive"
 
From Cosmology to Neuroscience to Rock Music and back
From Cosmology to Neuroscience to Rock Music and backFrom Cosmology to Neuroscience to Rock Music and back
From Cosmology to Neuroscience to Rock Music and back
 
Five Reasons why the Singularity is not coming any time soon
Five Reasons why the Singularity  is not coming any time soonFive Reasons why the Singularity  is not coming any time soon
Five Reasons why the Singularity is not coming any time soon
 
Artificial intelligence and the Singularity - History, Trends and Reality Check
Artificial intelligence and the Singularity - History, Trends and Reality CheckArtificial intelligence and the Singularity - History, Trends and Reality Check
Artificial intelligence and the Singularity - History, Trends and Reality Check
 
History of Thought - Part 6: The Modern Age
History of Thought - Part 6: The Modern AgeHistory of Thought - Part 6: The Modern Age
History of Thought - Part 6: The Modern Age
 

Recently uploaded

TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc
 
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodPolkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodJuan lago vázquez
 
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingRepurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingEdi Saputra
 
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc
 
HTML Injection Attacks: Impact and Mitigation Strategies
HTML Injection Attacks: Impact and Mitigation StrategiesHTML Injection Attacks: Impact and Mitigation Strategies
HTML Injection Attacks: Impact and Mitigation StrategiesBoston Institute of Analytics
 
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Miguel Araújo
 
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...Principled Technologies
 
AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAndrey Devyatkin
 
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024The Digital Insurer
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfsudhanshuwaghmare1
 
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, AdobeApidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobeapidays
 
GenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdfGenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdflior mazor
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityPrincipled Technologies
 
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUK Journal
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerThousandEyes
 
Real Time Object Detection Using Open CV
Real Time Object Detection Using Open CVReal Time Object Detection Using Open CV
Real Time Object Detection Using Open CVKhem
 
Top 10 Most Downloaded Games on Play Store in 2024
Top 10 Most Downloaded Games on Play Store in 2024Top 10 Most Downloaded Games on Play Store in 2024
Top 10 Most Downloaded Games on Play Store in 2024SynarionITSolutions
 
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...apidays
 
Why Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businessWhy Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businesspanagenda
 

Recently uploaded (20)

TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
 
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodPolkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
 
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingRepurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
 
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
 
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
 
HTML Injection Attacks: Impact and Mitigation Strategies
HTML Injection Attacks: Impact and Mitigation StrategiesHTML Injection Attacks: Impact and Mitigation Strategies
HTML Injection Attacks: Impact and Mitigation Strategies
 
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
 
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
 
AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of Terraform
 
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdf
 
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, AdobeApidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
 
GenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdfGenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdf
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivity
 
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
 
Real Time Object Detection Using Open CV
Real Time Object Detection Using Open CVReal Time Object Detection Using Open CV
Real Time Object Detection Using Open CV
 
Top 10 Most Downloaded Games on Play Store in 2024
Top 10 Most Downloaded Games on Play Store in 2024Top 10 Most Downloaded Games on Play Store in 2024
Top 10 Most Downloaded Games on Play Store in 2024
 
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
 
Why Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businessWhy Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire business
 

Christina Smolke (Stanford) at a LASER on "Synthetic Biology"

  • 1. Synthetic Biology: The next generation of biotechnology Christina D. Smolke Department of Bioengineering Stanford University July 9, 2012 LASER Talk, University of San Francisco
  • 2. Engineering systems Circuitry Sensors (Inputs) Circuitry signal processing remote control Signal Processing Temperature Chemicals memory automated response Automated Response Sensors (Inputs) Light dynamic controlTouch communication Dynamic Control Memor chemicals Remote control Communication biomolecules temperature light Actuators (Outputs) Actuators (Outputs) Motility Reporting reporting phenotype Delivery Self-Organization delivery self-organization Modify Environment motility synthesis
  • 3. Synthetic biology ensors (Inputs) Circuitry Circuitry Temperature Chemicals signalProcessing Signal processing remote control Light Automated Response automated response memory Touch Sensors (Inputs) Communication dynamicControl Dynamic control Memory communication Remote control chemicals biomolecules temperature light Actuators (Outputs) Actuators (Outputs) Motility Reporting reporting phenotype Delivery self-organization delivery Self-Organization motility synthesis Modify Environment
  • 4. Tools driving genetic engineering Recombinant DNA Polymerase Chain Reaction DNA Sequencing First Gen. Biotech = Basic “Cut” & “Paste” Amplify & Make Simple Changes Read Out the Genetic Code Insulin Production Erythropoietin Production ? 10-1000’s genes complex chemicals & materials organisms as products 1973 1985 …. bacterial cell culture, 1 gene mammalian cell culture, 1 gene
  • 5. Ongoing tools revolution Recombinant DNA Polymerase Chain Reaction DNA Sequencing First Gen. Biotech = Basic “Cut” & “Paste” Amplify & Make Simple Changes Read Out the Genetic Code Next Gen. Biotech Adds = ... New Tools c/o D. Endy (Stanford University)
  • 6. Transformative advances in fabrication platforms DNA Construction = #1 Tech. of 21st Ctry. From absract information to physical, living DNA designs. Organic chemistry Biochemistry nstruction = #1 Tech. of 21st Ctry. TAATACGACTCACTATAGGGAGA …TAATGCAGCTTATTACA…(<200 nt) enzymes 2004: 10,000 bp 2010: 1,000,000 bp 2016: 100 million? 26 (~1000 – ATACGACTCACTATAGGGAGA 10000 bp) A T G C
  • 7. Transformative advances in fabrication platforms Carr PA, Church GM. 2009. Nat Biotech. 27: 1151-1162 Cellular (in vivo) assembly 1 Mb+ engineered natural genome transplantation Gibson DG, et al. 2010. Science. 329: 52-6
  • 8. Now that we can write in DNA, what do we say? Challenge: Design Gap
  • 9. Buffe Inverter1+Invert Buff Inver 2xInvert Invert 2xInver Buffer1+Buff 2xBuf 2xBuf Inver Buf 2xInver 2xBuf Buf 2xBuf Buf 2xBuff D Buff 2xBuff output protein (high when AA) Biomanufacturing Platforms Next-Generation Therapies C AND gate D16 14.0 Device response in unit expression 14 A input A input B AB output Apps B 12 [SI 1.2] A B output 10 theo tc GFP 8 0 0 0 0 1 0 6 1 0 0 4 3.1 AAAAA AAA 1 1 1 2.0 2 0 0 GFP low low low high output protein (high when AB) theo + + tc + + Scalable Biological Computation E NOR gate F 10 9 8.1 Device response in unit expression input A input B Circuits A 8 A+B output B 7 [SI 1.3] A B output 6 theo tc GFP 5 0 0 1 4 0 1 0 3 2.0 1 0 0 AAAAA 2 1.1 1 1 0 1 0 0 GFP high low low low output protein (high when A+B) theo + + tc + + input module actuator module output module assembled RNA device I/O Tools Spatial Engineering Figure 2 F Win and Smolke protein sensor alternative exon inclusion gene of interest Tools Golgi
 Vacuole
 + + GOI GOI output 3’ss 5’ss ER
 The identity of the RNA sensor and Mitochondrion
 Nucleus
 its location in the intronic space will determine the effect of input binding exon inclusion exon exclusion input A on the device output. (low device output) (high device output) The Smolke Laboratory
  • 10. Molecular computers enable programming of function input sensor1 / transmitter1 / actuator output input A sensor1 / transmitter2 / actuator output input A sensor2 / transmitter1 / actuator output input B output input output Win MN, Smolke CD. 2007. PNAS. 104: 14283-8
  • 11. Molecular computers enable programming of function input sensor1 / transmitter1 / actuator output input A sensor1 / transmitter2 / actuator output input A sensor2 / transmitter1 / actuator output input B output n sensors / n transmitters / actuator A B output 0 0 1 0 1 1 1 0 1 1 1 0 Win MN, Smolke CD. 2008. Science. 322: 456-60
  • 12. Fluorescence low GFP AAA Atropine Cellular biosynthesis Muscarinic blocker platforms GFP AAA Paclitaxel Cancer Ligand present Ribozyme inactive GFP AAA Fluorescence high Digoxin Arrhythmias Ceftaroline Antibiotic Prostratin HIV 1 2
  • 13. H 3 CO H 3CO NCH3 NCH 3 HO HO O OH antimicrobial Norcoclaurine Coclaurine N-Methylcoclaurine anticancer Berbamunine Tyrosine BisBIAs 3’-Hydroxy-N- methylcoclaurine antiviral Norlaudanosoline 6-O-Methyl- norlaudanosoline Reticuline hair growth Salutaridinol-7- Salutaridinol Salutaridine O-acetate Scoulerine Tetrahydro- Canadine Berberine columbamine Thebaine Neopinone Codeinone antimicrobial Berberine branch analgesic antioxidant antitussive Cheilanthifoline Codeine Cis-N- Dihydro- Sanguinarine Stylopine Methylstylopine sanguinarine Morphine branch Morphine Sanguinarine branch Hawkins KM, Smolke CD. 2008. Nat Chem Biol. 4: 564
  • 14. Building a microbial drug factory Enzymes catalyze reactions:
  • 15. Building a microbial drug factory Bis-BIAs Sanguinarine / Morphinan Berberine Alkaloids Alkaloids O N O OMe OMe
  • 16. Building a microbial drug factory DNA protein metabolite Bis-BIAs Sanguinarine / Morphinan Berberine Alkaloids Alkaloids O N O OMe OMe
  • 17. Building a microbial drug factory Bis-BIAs Sanguinarine / Morphinan Berberine Alkaloids Alkaloids O N O OMe OMe
  • 18. Building a microbial drug factory Bis-BIAs Sanguinarine / Morphinan Berberine Alkaloids Alkaloids O N O OMe OMe
  • 19. Building a microbial drug factory Bis-BIAs Sanguinarine / Morphinan Berberine Alkaloids Alkaloids O N O OMe OMe
  • 20. Molecular tools for optimizing metabolite production Challenge: Often need to screen through large libraries of pathway/enzyme variants – invasive / analytical procedures are too time and resource intensive Solution: Engineer scalable platforms for noninvasive sensors of metabolite concentrations in single living cells AAA AAA
  • 21. I/O tools as noninvasive, real-time metabolite sensors AAAA GFP Ligand absent Ribozyme active GFP AAA Fluorescence low Ligand absent Ribozyme active GFP AAAA AAA GFP Fluorescence low AAA Ligand absent GFP Ribozyme active GFP AAA Fluorescence low GFP AAA GFP GFP AAA AAAA GFP AAA GFP AAA Ligand present Ribozyme inactive GFP GFP AAA AAA Fluorescence high GFP AAAA Ligand present Ribozyme inactive GFP AAA Michener JK, Smolke CD. 2012. Metab Eng. In press Fluorescence high Ligand present Ribozyme inactive GFP AAA
  • 22. Evolution… in the laboratory mutagenesis … identify best variant X
  • 23. High-throughput enzyme library screening methods plate-based assay (library size: ~103) FACS-based screen (library size: ~106-107) Molecular computer links enzyme activity to fluorescence Michener JK, Smolke CD. 2012. Metab Eng. In press
  • 24. Li 2 0.1 a yCDM1 yCDM3 yCDM5 yCDM6 yCDM7 yCDM8 (-) Control b 1.8 300 α-actin α-V5 KM, app 0 1.6 0.0 Selectivity 250 0% 20% 40% 60% 80% 100%1.4 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 Rapid Fluorescence Change of enzymes with improved activities identification Relative Activity KM, app (mM) 200 Selectivity 1.2 35 c 0.8 d1.0 vmax, app/KM, app 150 0.8 30 Library Frequency Theophylline production Fold Improvement 0.7 Relative Enzyme model1.0x 1.0x Expression 0.6 1.0x 1.2x 0.9x 0.7x 0.0x 0.6 0.4 25 100 0.5 50 c 0.2 20 0.4 0.0 0 yCDM1 yCDM3 yCDM5 yCDM6 yCDM7 yCDM8 0.3 15 0.2 56 d 10 0.1 54 0.0 5 Post-sort #3 52 0.0 0.2 Post-sort #1 T50 (oC) 0.4 0.6 Pre-sort #1 50 0 0.8 1.0 yCDM1 yCDM2 yCDM3 yCDM4 yCDM5 yCDM6 yCDM7 yCDM8 1.2 48 Relative Activity Plate Based FACS 46 a yCDM1 yCDM3 yCDM5 yCDM6 yCDM7 yCDM8 (-) Control 44b 1.8 300 α-actin α-V5 KM, app 1.6 Selectivity 42 250 1.4 40 Wildtype yCDM1 yCDM3 yCDM5 yCDM6 yCDM7 yCDM8 KM, app (mM) 200 Selectivity 1.2 1.0 150 0.8 Relative 0.6 100 Catalytic 1.0x 1.2x and selectivity 1.0x Expression activity 1.0x 0.9x 0.7x 0.0x 0.4 increases through evolutionary 50 c 0.2 trajectory 0.0 yCDM1 yCDM3 yCDM5 yCDM6 yCDM7 yCDM8 0 Michener JK, Smolke CD. 2012. Metab Eng. In press 56 d 54
  • 25. Cellular therapies: engineering the immune system transfer engineered cells into patient harvest lymphocytes recover and engineer from patient desired cell type http://www.discoverymedicine.com/Leslie-E-Huye/files/2010/03/
  • 26. A molecular computer controlling immune response proliferation apoptosis / death Chen YY, Jensen MC, Smolke CD. 2010. PNAS. 107: 8531-6
  • 27. A molecular computer controlling immune response 1.2E+09 L2bulge9(3x)
No
Theo
 L2bulge9(3x) 0 uM Theo Flux (photons/sec) 1.0E+09 No drug L2bulge9(3x)
500
μM
Theo
 L2bulge9(3x) 500 uM Theo 8.0E+08 6.0E+08 4.0E+08 2.0E+08 0.0E+00 0 2 4 6 8 10 12 14 16 Days Post Injection With drug Chen YY, Jensen MC, Smolke CD. 2010. PNAS. 107: 8531-6
  • 28. Apps Standardization Abstraction Synthesis Device Design Languages & Grammar AGGTACAGTTATCA CCCATTGCATGGTA TTCAAAGAAGTCGT output GGCCCAGATTCGAC AAATCGTGTAGTAA TGGTCCAGCTGATT input Tools GGTTCAAATAACGG
  • 29. Postdoctoral Researchers The Smolke Laboratory Kate Thodey Eric Hayden Graduate Researchers Ryan Bloom Andy Chang Leo d’Espaux Stephanie Galanie Katie Galloway Drew Kennedy Joe Liang Melina Mathur Josh Michener Michael Siddiqui Isis Trenchard Jay Vowles Alumni Collaborators Yen-Hsiang Wang Andrew Babiskin Michael Jensen (SCRI, FHCRC) Kathy Wei Travis Bayer Remus Wong Chase Beisel Funding Sources Yvonne Chen Defense Advanced Research Projects Stephanie Culler Agency Kristy Hawkins Bill and Melinda Gates Foundation Kevin Hoff National Institutes of Health (NIGMS, NCI) Maung Nyan Win National Science Foundation (CBET, CCF)